|
| Status |
Public on Dec 02, 2010 |
| Title |
L1_arrest |
| Sample type |
SRA |
| |
|
| Source name |
wild-type L1 arrest
|
| Organism |
Caenorhabditis elegans |
| Characteristics |
strain: wild-type N2_hermaphrodites
developmental stage: developmentally arrested L1
growth condition: 20 °C
stress conditions: L1s without food for 48 hrs
|
| Treatment protocol |
Wild-type N2 young adults were exposed to each stress during Day 0 stage (day X represents days post-L4 molt), 6 hrs at 32 °C for heat shock treatment and 12 hrs for PA14 exposure. RNAs were purified from Day 1 stage animals just after stress treatment together with the untreated control. As for L1 arrest sample, prepared embryos were incubated without a food source in M9 buffer for 48 hrs, and then used for RNAs preparation.
|
| Growth protocol |
Wild-type N2 hermaphrodites were maintained for a few generations without starvation at 20 °C to collect embryos. After embryos were harvested, they were incubated at 20 °C without a food source in M9 buffer for 24 hrs with rotation to arrest their growth at the L1 stage. Synchronized animals were exposed to each stress when they were Day 0 young adult (day X represents days post-L4 molt). As for L1 arrest sample, embryos were prepared in a similar manner but incubated without food for 48 hrs.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNAs were prepared using the mirVana miRNA Isolation kit (Ambion), and 10 μg of total RNAs were used for cDNA library preparation for small RNAs using the DGE-Small RNA Sample Prep Kit ver. 1.0 (Illumina) according to the manufacturers' instructions.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Data processing |
The raw data were aligned to the C. elegans genome (genome build WormBase WS190) using the SOAP program (ver. 1.10 Li, R. et al., Bioinformatics 24: 713-714. 2008) with the following command options: –w 5 –S 3 –A TCGTATGCCGTCTTCTGCTTGT (maximum 2 base pair mismatches were allowed as a default option). Then, the number of times of each read sequenced was examined.
|
| |
|
| Submission date |
Dec 01, 2010 |
| Last update date |
May 15, 2019 |
| Contact name |
Frank J Slack |
| E-mail(s) |
frank.slack@yale.edu
|
| Organization name |
Yale University
|
| Department |
MCDB
|
| Street address |
266 Whitney Ave
|
| City |
New Haven |
| State/province |
CT |
| ZIP/Postal code |
06520 |
| Country |
USA |
| |
|
| Platform ID |
GPL9269 |
| Series (1) |
| GSE25739 |
Changes in expression of small non-coding RNAs, including microRNAs, in response to stress in C. elegans |
|
| Relations |
| SRA |
SRX033026 |
| BioSample |
SAMN00139638 |
