|
Status |
Public on Oct 30, 2012 |
Title |
WT ox |
Sample type |
SRA |
|
|
Source name |
Young adult C. elegans
|
Organism |
Caenorhabditis elegans |
Characteristics |
strain: Bristol N2 background developmental stage: Young adult C. elegans rna treatment: oxidised
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. RNA was then oxidised using NaIO4 and quenched using glycerol. After gel isolation 5' and 3' adaptors were ligated.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina Genome Analyzer II |
|
|
Description |
Small RNA sequence data 5' barcode ACTA, 3' adapter TCGTATGCCGTCTTCTGCTTG
|
Data processing |
3' adapter sequences were trimmed and inserts longer than 18 nt were mapped to the C. elegans genome (WS220)
|
|
|
Submission date |
Aug 31, 2011 |
Last update date |
May 15, 2019 |
Contact name |
Eugene Berezikov |
E-mail(s) |
e.berezikov@umcg.nl
|
Phone |
+31 50 361 73 00
|
Organization name |
University Medical Center Groningen
|
Department |
European Research Institute for the Biology of Ageing
|
Street address |
Antonius Deusinglaan 1
|
City |
Groningen |
ZIP/Postal code |
9713AV |
Country |
Netherlands |
|
|
Platform ID |
GPL9269 |
Series (1) |
|
Relations |
SRA |
SRX095335 |
BioSample |
SAMN00715029 |