NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM788485 Query DataSets for GSM788485
Status Public on Oct 30, 2012
Title WT ox
Sample type SRA
 
Source name Young adult C. elegans
Organism Caenorhabditis elegans
Characteristics strain: Bristol N2 background
developmental stage: Young adult C. elegans
rna treatment: oxidised
Extracted molecule total RNA
Extraction protocol Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. RNA was then oxidised using NaIO4 and quenched using glycerol. After gel isolation 5' and 3' adaptors were ligated.
 
Library strategy RNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina Genome Analyzer II
 
Description Small RNA sequence data
5' barcode ACTA, 3' adapter TCGTATGCCGTCTTCTGCTTG
Data processing 3' adapter sequences were trimmed and inserts longer than 18 nt were mapped to the C. elegans genome (WS220)
 
Submission date Aug 31, 2011
Last update date May 15, 2019
Contact name Eugene Berezikov
E-mail(s) e.berezikov@umcg.nl
Phone +31 50 361 73 00
Organization name University Medical Center Groningen
Department European Research Institute for the Biology of Ageing
Street address Antonius Deusinglaan 1
City Groningen
ZIP/Postal code 9713AV
Country Netherlands
 
Platform ID GPL9269
Series (1)
GSE31783 rem-1 analysis in C. elegans
Relations
SRA SRX095335
BioSample SAMN00715029

Supplementary file Size Download File type/resource
GSM788485_celegans_libWTOX.processed.txt.gz 449.1 Kb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap