|
Status |
Public on Oct 30, 2012 |
Title |
WT TAP |
Sample type |
SRA |
|
|
Source name |
Young adult C. elegans
|
Organism |
Caenorhabditis elegans |
Characteristics |
strain: Bristol N2 background developmental stage: Young adult C. elegans rna treatment: TAP treated
|
Extracted molecule |
total RNA |
Extraction protocol |
Total RNA was isolated using fast protK mediated lysis and Trizol LS protocols. RNA was then treated with Tobacco Acid Pyrophosphatase according manufactorers conditions. 5' and 3' adapttors were ligated.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina Genome Analyzer II |
|
|
Description |
Small RNA sequence data 5' barcode TACA, 3' adapter TCGTATGCCGTCTTCTGCTTG
|
Data processing |
3' adapter sequences were trimmed and inserts longer than 18 nt were mapped to the C. elegans genome (WS220)
|
|
|
Submission date |
Aug 31, 2011 |
Last update date |
May 15, 2019 |
Contact name |
Eugene Berezikov |
E-mail(s) |
e.berezikov@umcg.nl
|
Phone |
+31 50 361 73 00
|
Organization name |
University Medical Center Groningen
|
Department |
European Research Institute for the Biology of Ageing
|
Street address |
Antonius Deusinglaan 1
|
City |
Groningen |
ZIP/Postal code |
9713AV |
Country |
Netherlands |
|
|
Platform ID |
GPL9269 |
Series (1) |
|
Relations |
SRA |
SRX095336 |
BioSample |
SAMN00715030 |