|
Status |
Public on Jul 27, 2024 |
Title |
clsy4-kd, Leaf |
Sample type |
SRA |
|
|
Source name |
Leaf (60 days old)
|
Organism |
Oryza sativa |
Characteristics |
tissue: Leaf (60 days old) subspecies: Indica cultivar: Pusa Basmati1 (PB1)
|
Treatment protocol |
WT tissues were handled in the same manner. Treated with Zymo bisulfite reagents
|
Growth protocol |
The plants were grown in green house with natural day-night cycles with temperature maintained around 28 degrees celsius.
|
Extracted molecule |
genomic DNA |
Extraction protocol |
Total DNA was extracted from the tissues using CTAB method. Bisulfite convertion by EZ DNA Methylation-Gold Kit (Catalog no-D5005) as per manufacturer’s protocol. Adapters used: Read1- AGATCGGAAGAGCACACGTCTGAACTCCAGTCA and Read 2-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT . library constructed using NEBNext® Ultra™ II DNA Library Prep with Sample Purification Beads (Catalog no-E7103L) as per manufacturer's instructions.
|
|
|
Library strategy |
Bisulfite-Seq |
Library source |
genomic |
Library selection |
RANDOM |
Instrument model |
Illumina NovaSeq 6000 |
|
|
Data processing |
Adapter was removed and low quality bases were trimmed from sequenced reads using cutadapt. The reads were aligned to PCR templates as genome using Bismark and methylation extraction was done using Bismark protocol. The methylation was calculated using the Bismark tool and cytosine coverage report was used to create the bedgraph files for methylation density. Assembly: Custome genome built from Oryza sativa japonica nipponbare genome – IRGSP1 with the PCR amplicon regions as template. Supplementary files format and content: Processed files contain cytosine report in text format which generated from Bismark alignment tool.
|
|
|
Submission date |
Feb 29, 2024 |
Last update date |
Jul 27, 2024 |
Contact name |
Shivaprasad Padubidri V. |
E-mail(s) |
shivaprasad@ncbs.res.in, epigeneticsncbsindia@gmail.com, harshith200cy@gmail.com
|
Phone |
+91-80-2366-6511
|
Organization name |
National Centre for Biological Sciences - TIFR
|
Street address |
UAS-GKVK Campus
|
City |
Bangalore |
ZIP/Postal code |
560065 |
Country |
India |
|
|
Platform ID |
GPL27660 |
Series (2) |
GSE229961 |
Upstream regulator of genomic imprinting in rice is a small RNA-associated chromatin remodeler |
GSE260648 |
Upstream regulator of genomic imprinting in rice is a small RNA-associated chromatin remodeler [bisulfite_PCR] |
|
Relations |
BioSample |
SAMN40210332 |
SRA |
SRX23802499 |