|
Status |
Public on Jul 27, 2024 |
Title |
CLSY3_GFP_Panicle_Rep1 |
Sample type |
SRA |
|
|
Source name |
Panicle (before anthesis)
|
Organism |
Oryza sativa |
Characteristics |
tissue: Panicle (before anthesis) subspecies: Indica cultivar: Pusa Basmati1 (PB1)
|
Treatment protocol |
Panicle tissues were handled in the same manner.
|
Growth protocol |
The plants were grown in green house with natural day-night cycles with temperature maintained around 28 degrees celsius.
|
Extracted molecule |
genomic DNA |
Extraction protocol |
Sheared chromatin from the equally developed pre emerged panicle of WT and kd plants were incubated with appropriate antibodies bound to Protein G Dynabeads (Thermo Fisher, catalog number 10003D). Washes, elution, de-crosslinking and DNA. purification was done as described. The purified DNA was taken for library preparation. Antibody used (GFP-Sigma G1544) and (myc-Abcam ab9106). The ChIP library was constructed using NEBNext® Ultra™ II DNA Library Prep with Sample Purification Beads (Catalog no-E7103L) as per manufacturer's instructions. The adapter sequence used AGATCGGAAGAGCACACGTCTGAACTCCAGTCA and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT
|
|
|
Library strategy |
ChIP-Seq |
Library source |
genomic |
Library selection |
ChIP |
Instrument model |
Illumina NovaSeq 6000 |
|
|
Data processing |
Adaptor trimming by cutadapt. The reads obtained were trimmed using cutadapt and aligned to IRGSP1 rice genome with parameters -q -v 3 -k 1 -y -a --best –strata The alignment files are converted to coverage files using bam coverage tool of Deeptools with the 5bp bin size. Assembly: Oryza sativa japonica Nipponbare genome – IRGSP1 Supplementary files format and content: The coverage files of the ChIP-seq alignments were provided in bigwig format.
|
|
|
Submission date |
Feb 29, 2024 |
Last update date |
Sep 18, 2024 |
Contact name |
Shivaprasad Padubidri V. |
E-mail(s) |
shivaprasad@ncbs.res.in, epigeneticsncbsindia@gmail.com, harshith200cy@gmail.com
|
Phone |
+91-80-2366-6511
|
Organization name |
National Centre for Biological Sciences - TIFR
|
Street address |
UAS-GKVK Campus
|
City |
Bangalore |
ZIP/Postal code |
560065 |
Country |
India |
|
|
Platform ID |
GPL27660 |
Series (2) |
GSE229961 |
Upstream regulator of genomic imprinting in rice is a small RNA-associated chromatin remodeler |
GSE260649 |
Upstream regulator of genomic imprinting in rice is a small RNA-associated chromatin remodeler [ChIP_seq] |
|
Relations |
SRA |
SRX23802507 |
BioSample |
SAMN40210341 |