NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL18602 Query DataSets for GPL18602
Status Public on Apr 23, 2014
Title [OncoScan] Affymetrix OncoScan FFPE Assay
Technology type in situ oligonucleotide
Distribution commercial
Organism Homo sapiens
Manufacturer Affymetrix
Manufacture protocol see manufacturer's web site
 
Description #OncoScan.na33.r1.annot.csv
#%create_date=2013-09-24 GMT-08:00 18:05:59
#%chip_type=OncoScan
#%genome-species=Homo sapiens
#%genome-version=hg19
#%genome-version-ucsc=hg19
#%genome-version-ncbi=37
#%genome-version-create_date=2009-02-00
#%dbSNP-date=2011-03-11
#%dbSNP-version=135
#%hapmap-date=2008-01-08
#%hapmap-version=23
#%dgv-date=2010-10-00
#%dgv-version=10
#%netaffx-annotation-date=2012-11-05
#%netaffx-annotation-netaffx-build=33
 
Web link http://www.affymetrix.com/support/technical/byproduct.affx?product=oncoscan_assay_kits
Submission date Apr 23, 2014
Last update date Jul 22, 2014
Organization Affymetrix, Inc.
E-mail(s) geo@ncbi.nlm.nih.gov, support@affymetrix.com
Phone 888-362-2447
URL http://www.affymetrix.com/index.affx
Street address
City Santa Clara
State/province CA
ZIP/Postal code 95051
Country USA
 
Samples (1038) GSM1568172, GSM1568173, GSM1568174, GSM1568175, GSM1638949, GSM1638950 
Series (58)
GSE64293 Affymetrix OncoScan FFPE Array array data from Li-Fraumeni Syndrome tumors
GSE67107 Genomewide copy number profiles for Adenosarcoma patients in Taiwan
GSE71386 Paired copy number analysis of Diffuse Large B Cell Lymphoma [OncoScan]

Data table header descriptions
ID
dbSNP RS ID
Chromosome
Physical Position
Strand
Strand Versus dbSNP
ChrX pseudo-autosomal region 1
ChrX pseudo-autosomal region 2
Cytoband
Flank
Allele A
Allele B
In Hapmap
Probe Count
Process Flag
% GC
Copy Number Variation
Genetic Map
Microsatellite
Associated Gene
OMIM
SPOT_ID

Data table
ID dbSNP RS ID Chromosome Physical Position Strand Strand Versus dbSNP ChrX pseudo-autosomal region 1 ChrX pseudo-autosomal region 2 Cytoband Flank Allele A Allele B In Hapmap Probe Count Process Flag % GC Copy Number Variation Genetic Map Microsatellite Associated Gene OMIM SPOT_ID
S-tag000001 rs38744 7 111048579 + same 0 0 q31.1 ATAAAGATTTTTCTAGTGCATCAT[A/G]TCACAGAACTGCAAGCATA A G YES 6 3 A // 14.0000 /// local // 0.3672 Variation_10206 // 7:111044971-111112853 // Illumina HumanHap550 BeadChip // 17921354 // Wang et al. (2007) // CopyNumber /// Variation_103745 // 7:111048575-111056882 // Affymetrix Human SNP array 6.0 and Illumina Human 1M BeadChip // 20811451 // Altshuler et al. (2010) // CopyNumber /// Variation_1163 // 7:111048579-111080407 // Mendelian inconsistencies // 16327808 // Conrad et al. (2005) // CopyNumber /// Variation_3698 // 7:110800911-111304825 // BAC Array CGH // 17122850 // Redon et al. (2006) // CopyNumber /// Variation_38653 // 7:111048575-111056882 // Affymetrix SNP 6.0 Array // 18776908 // McCarroll et al. (2008) // CopyNumber /// Variation_52053 // 7:110813808-111048579 // Illumina HumanHap550 V1 BeadChip // 19592680 // Shaikh et al. (2009) // CopyNumber /// Variation_52056 // 7:111048579-111078912 // Illumina HumanHap550 V1 BeadChip // 19592680 // Shaikh et al. (2009) // CopyNumber /// Variation_5401 // 7:110821726-111158074 // Illumina HumanHap300 BeadChip // 17116639 // Simon-Sanchez et al. (2007) // CopyNumber /// Variation_64920 // 7:111022673-111100065 // Agilent custom oligo CGH array // 19812545 // Conrad et al. (2009) // CopyNumber /// Variation_64921 // 7:111022673-111100065 // Agilent custom oligo CGH array // 19812545 // Conrad et al. (2009) // CopyNumber /// Variation_9066 // 7:110787970-111113591 // Affymetrix 500K SNP Mapping Array // 17911159 // Pinto et al. (2007) // CopyNumber /// Variation_9067 // 7:110981049-111114049 // Affymetrix 500K SNP Mapping Array // 17911159 // Pinto et al. (2007) // CopyNumber /// Variation_9068 // 7:111007049-111318464 // Affymetrix 500K SNP Mapping Array // 17911159 // Pinto et al. (2007) // CopyNumber /// Variation_94810 // 7:111046925-111091760 // Custom Affymetrix oligonucleotide arrays // 19900272 // Matsuzaki et al. (2009) // CopyNumber deCODE // 120.1430 // 156.0457 // 84.2403 /// Marshfield // 121.7801 // 153.0385 // 91.1885 /// SLM1 // 116.5145 // 147.2000 // 87.5316 D7S1559 // downstream // 65157 /// D7S2860 // upstream // 69352 ENST00000331762 // intron // 0 // Hs.731706 // IMMP2L // 83943 // IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) /// ENST00000405709 // intron // 0 // Hs.731706 // IMMP2L // 83943 // IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) /// ENST00000415362 // intron // 0 // Hs.731706 // IMMP2L // 83943 // IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) /// ENST00000437687 // intron // 0 // Hs.731706 // IMMP2L // 83943 // IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) /// ENST00000447215 // intron // 0 // Hs.731706 // IMMP2L // 83943 // IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) /// ENST00000452895 // intron // 0 // Hs.731706 // IMMP2L // 83943 // IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) /// NM_001244606 // intron // 0 // Hs.731706 // IMMP2L // 83943 // IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) /// NM_032549 // intron // 0 // Hs.731706 // IMMP2L // 83943 // IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) --- dbSNP RS ID: rs38744
S-tag000002 rs148371779 X 132363050 + same 0 0 q26.2 TGGACATGTTCTGGGCAAA[C/T]GACAGGAAGCAGAAGAGC T C --- 6 3 A // 19.0000 /// local // 0.4175 --- deCODE // 135.4540 // 135.4540 // --- /// Marshfield // 82.3105 // 143.7209 // 22.7700 /// SLM1 // 95.4483 // 148.8276 // 43.6000 DXS7853 // downstream // 63778 /// DXS6748 // upstream // 34505 ENST00000310125 // upstream // 10674 // Hs.142908 // TFDP3 // 51270 // transcription factor Dp family, member 3 /// ENST00000365329 // downstream // 9635 // --- // --- // --- // --- /// NM_001448 // downstream // 72014 // Hs.58367 // GPC4 // 2239 // glypican 4 /// NM_016521 // upstream // 10674 // Hs.142908 // TFDP3 // 51270 // transcription factor Dp family, member 3 --- dbSNP RS ID: rs148371779
S-tag000003 rs11048499 12 26556111 + same 0 0 p11.23 AACACAGGATGAGCAAAGG[C/T]AAACAGGCACAAAAGCATG T C YES 6 3 A // 17.0000 /// local // 0.3898 --- deCODE // 48.8394 // 45.2923 // 52.3843 /// Marshfield // 46.4268 // 47.5810 // 44.6770 /// SLM1 // 46.4646 // 48.5432 // 45.1000 D12S2033 // downstream // 65767 /// D12S1316 // upstream // 303688 ENST00000381340 // intron // 0 // Hs.512235 // ITPR2 // 3709 // inositol 1,4,5-trisphosphate receptor, type 2 /// ENST00000451599 // intron // 0 // Hs.512235 // ITPR2 // 3709 // inositol 1,4,5-trisphosphate receptor, type 2 /// ENST00000535324 // intron // 0 // Hs.577737 // --- // --- // Transcribed locus /// NM_002223 // intron // 0 // Hs.512235 // ITPR2 // 3709 // inositol 1,4,5-trisphosphate receptor, type 2 --- dbSNP RS ID: rs11048499
S-tag000004 rs7748125 6 103391000 + same 0 0 q16.3 CTACACAAAAGTAACATCATTACTAT[A/G]TGACATGCATCAAGAACCAT A G YES 6 0 A // 15.0000 /// local // 0.3454 Variation_7512 // 6:103274726-103502648 // Agilent 185k CGH Arrays/Agilent Custom CGH Arrays // 17666407 // de Smith et al. (2007) // CopyNumber deCODE // 106.5001 // 139.7210 // 73.2800 /// Marshfield // 110.5774 // 147.6570 // 74.3800 /// SLM1 // 107.7904 // 132.2130 // 84.4904 D6S2160 // downstream // 198647 /// D6S1580 // upstream // 79186 ENST00000407015 // upstream // 59389 // --- // --- // --- // --- /// ENST00000407792 // upstream // 489333 // --- // --- // --- // --- /// NM_001166247 // downstream // 873042 // Hs.98262 // GRIK2 // 2898 // glutamate receptor, ionotropic, kainate 2 /// NM_020771 // downstream // 1784968 // Hs.434340 // HACE1 // 57531 // HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 138244 // Mental retardation, autosomal recessive, 6 // 611092 // downstream dbSNP RS ID: rs7748125
S-tag000005 rs10895822 11 97346172 + same 0 0 q22.1 CACAACAAGAAGGTGTAAGAAG[C/T]AGAATTGGCTGAAATTAAGGAA T C YES 6 3 A // 16.0000 /// local // 0.3564 Variation_0309 // 11:97260050-97441173 // ROMA // 15273396 // Sebat et al. (2004) // CopyNumber deCODE // 100.7534 // 136.6800 // 64.8368 /// Marshfield // 93.9171 // 112.5380 // 74.7751 /// SLM1 // 85.2900 // 109.0900 // 61.7836 D11S2070 // downstream // 144990 /// D11S920 // upstream // 111244 ENST00000362445 // upstream // 182292 // --- // --- // --- // --- /// ENST00000529088 // upstream // 215185 // --- // --- // --- // --- /// NM_001243271 // upstream // 1545534 // Hs.656783 // CNTN5 // 53942 // contactin 5 /// NR_047481 // upstream // 1106131 // --- // JRKL-AS1 // 100874053 // JRKL antisense RNA 1 (non-protein coding) --- dbSNP RS ID: rs10895822
S-tag000007 rs10277237 7 150683344 + same 0 0 q36.1 CTGGATCCGCGCAGCA[A/G]AACAACATCTCCTCTAGGAAG A G YES 6 3 A // 20.0000 /// local // 0.5118 --- deCODE // 162.0613 // 211.6383 // 112.4824 /// Marshfield // 161.6459 // 209.9813 // 113.6900 /// SLM1 // 159.5107 // 204.6000 // 116.8000 D7S1826 // downstream // 59275 /// D7S759 // upstream // 11234 ENST00000262186 // upstream // 7941 // Hs.647099 // KCNH2 // 3757 // potassium voltage-gated channel, subfamily H (eag-related), member 2 /// ENST00000297494 // upstream // 4739 // Hs.647092 // NOS3 // 4846 // nitric oxide synthase 3 (endothelial cell) /// NM_000603 // upstream // 4800 // Hs.647092 // NOS3 // 4846 // nitric oxide synthase 3 (endothelial cell) /// NM_172056 // upstream // 7942 // Hs.647099 // KCNH2 // 3757 // potassium voltage-gated channel, subfamily H (eag-related), member 2 152427 // Long QT syndrome-2 // 613688 // upstream /// 152427 // {Long QT syndrome-2, acquired, susceptibility to} // 613688 // upstream /// 152427 // Short QT syndrome-1 // 609620 // upstream /// 163729 // {Coronary artery spasm 1, susceptibility to} // --- // upstream /// 163729 // {Alzheimer disease, late-onset, susceptibility to} // 104300 // upstream /// 163729 // {Hypertension, susceptibility to} // 145500 // upstream /// 163729 // {Hypertension, pregnancy-induced} // 189800 // upstream /// 163729 // {Placental abruption} // --- // upstream /// 163729 // {Ischemic stroke, susceptibility to} // 601367 // upstream /// 152427 // Long QT syndrome-2 // 613688 // upstream /// 152427 // {Long QT syndrome-2, acquired, susceptibility to} // 613688 // upstream /// 152427 // Short QT syndrome-1 // 609620 // upstream /// 163729 // {Coronary artery spasm 1, susceptibility to} // --- // upstream /// 163729 // {Alzheimer disease, late-onset, susceptibility to} // 104300 // upstream /// 163729 // {Hypertension, susceptibility to} // 145500 // upstream /// 163729 // {Hypertension, pregnancy-induced} // 189800 // upstream /// 163729 // {Placental abruption} // --- // upstream /// 163729 // {Ischemic stroke, susceptibility to} // 601367 // upstream dbSNP RS ID: rs10277237
S-tag000009 rs4940383 18 46002758 + same 0 0 q21.1 CACTCATACCTCATAACAACCC[A/G]TAAGTACAGAGGTACGAAGG A G YES 6 3 A // 19.0000 /// local // 0.4639 --- deCODE // 68.8946 // 85.1392 // 52.6600 /// Marshfield // 68.5668 // 89.3886 // 48.5600 /// SLM1 // 69.1545 // 75.4487 // 63.2434 D18S455 // downstream // 81054 /// D18S450 // upstream // 42225 ENST00000256413 // upstream // 62659 // Hs.145230 // CTIF // 9811 // CBP80/20-dependent translation initiation factor /// ENST00000364002 // upstream // 787 // --- // --- // --- // --- /// NM_001039360 // upstream // 339078 // Hs.515388 // ZBTB7C // 201501 // zinc finger and BTB domain containing 7C /// NM_001142397 // upstream // 62669 // Hs.145230 // CTIF // 9811 // CBP80/20-dependent translation initiation factor --- dbSNP RS ID: rs4940383
S-tag000010 rs11779409 8 136597761 + same 0 0 q24.23 TCACCTTTTTATTCCCAATAACTA[A/G]TATATAATGTCTGGCACATAGTA A G YES 6 0 A // 14.0000 /// local // 0.4160 --- deCODE // 148.3495 // 195.7790 // 100.9163 /// Marshfield // 153.6283 // 209.2700 // 98.4539 /// SLM1 // 138.1180 // 170.7180 // 108.4690 D8S2049 // downstream // 23734 /// D5S1940 // upstream // 38127 ENST00000355849 // intron // 0 // Hs.444558 // KHDRBS3 // 10656 // KH domain containing, RNA binding, signal transduction associated 3 /// ENST00000517859 // intron // 0 // Hs.444558 // KHDRBS3 // 10656 // KH domain containing, RNA binding, signal transduction associated 3 /// ENST00000520981 // intron // 0 // Hs.444558 // KHDRBS3 // 10656 // KH domain containing, RNA binding, signal transduction associated 3 /// ENST00000522079 // intron // 0 // Hs.444558 // KHDRBS3 // 10656 // KH domain containing, RNA binding, signal transduction associated 3 /// ENST00000524199 // intron // 0 // Hs.444558 // KHDRBS3 // 10656 // KH domain containing, RNA binding, signal transduction associated 3 /// ENST00000524282 // intron // 0 // Hs.444558 // KHDRBS3 // 10656 // KH domain containing, RNA binding, signal transduction associated 3 /// NM_006558 // intron // 0 // Hs.444558 // KHDRBS3 // 10656 // KH domain containing, RNA binding, signal transduction associated 3 --- dbSNP RS ID: rs11779409
S-tag000012 rs7425967 2 228254536 + same 0 0 q36.3 AGAACATCTAGCCATAATACAA[C/T]AGTGATTAAATTCAGCTGTCTT T C --- 6 0 A // 14.0000 /// local // 0.4005 Variation_103424 // 2:228243310-228258857 // Affymetrix Human SNP array 6.0 and Illumina Human 1M BeadChip // 20811451 // Altshuler et al. (2010) // CopyNumber /// Variation_50408 // 2:228244397-228258288 // Illumina HumanHap550 V1 BeadChip // 19592680 // Shaikh et al. (2009) // CopyNumber /// Variation_63319 // 2:228241147-228258447 // Agilent custom oligo CGH array // 19812545 // Conrad et al. (2009) // CopyNumber /// Variation_9442 // 2:228244397-228258288 // Illumina HumanHap550 BeadChip // 17921354 // Wang et al. (2007) // CopyNumber deCODE // 230.6684 // 300.6968 // 160.6400 /// Marshfield // 229.1356 // 294.7716 // 164.0112 /// SLM1 // 212.7348 // 258.3403 // 167.3265 D2S2842 // downstream // 32203 /// D2S401 // upstream // 3594 ENST00000409979 // upstream // 82332 // Hs.352962 // AGFG1 // 3267 // ArfGAP with FG repeats 1 /// ENST00000449706 // upstream // 7825 // Hs.156652 // TM4SF20 // 79853 // transmembrane 4 L six family member 20 /// NM_024795 // upstream // 10514 // Hs.156652 // TM4SF20 // 79853 // transmembrane 4 L six family member 20 /// NR_049888 // upstream // 82312 // --- // MIR5703 // 100847081 // microRNA 5703 --- dbSNP RS ID: rs7425967
S-tag000014 rs4685575 3 2924686 - reverse 0 0 p26.2 CATTTAAAGCAGGTCCTATCTC[C/T]AGCAGTCATGAATTGTGGC T C YES 6 0 A // 18.0000 /// local // 0.3940 Variation_5211 // 3:2142080-3356591 // Illumina HumanHap300 BeadChip // 17116639 // Simon-Sanchez et al. (2007) // CopyNumber /// Variation_53518 // 3:2309379-2952214 // Illumina HumanHap300, Illumina HumanHap240S, Illumina HumanHap650Y, Illumina HumanHap550 BeadChips // 19166990 // Itsara et al. (2009) // CopyNumber /// Variation_8407 // 3:2242441-3220570 // Affymetrix 500K SNP Mapping Array // 17911159 // Pinto et al. (2007) // CopyNumber deCODE // 7.6712 // 3.1461 // 12.1964 /// Marshfield // 11.7554 // 4.5984 // 18.6096 /// SLM1 // 11.4212 // 3.9803 // 19.6424 D3S4051 // downstream // 131684 /// D3S2358 // upstream // 34687 ENST00000358480 // intron // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 /// ENST00000397461 // intron // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 /// ENST00000418658 // intron // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 /// ENST00000427331 // intron // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 /// ENST00000427741 // intron // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 /// ENST00000430505 // intron // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 /// ENST00000438282 // intron // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 /// ENST00000473058 // intron // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 /// ENST00000473173 // exon // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 /// NM_001206955 // intron // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 /// NM_175607 // intron // 0 // Hs.298705 // CNTN4 // 152330 // contactin 4 --- dbSNP RS ID: rs4685575
S-tag000016 rs193256295 10 104353108 - reverse 0 0 q24.32 AAAGGAGAAAACCAAGGCC[C/T]GAGCAACTCAAGATGTGTCC T C --- 6 3 A // 19.0000 /// local // 0.4918 --- deCODE // 122.2013 // 158.8115 // 85.5910 /// Marshfield // 124.7707 // 158.4685 // 91.8191 /// SLM1 // 117.5215 // 136.1087 // 99.0868 D10F2861E // downstream // 113744 /// D10S1697 // upstream // 18688 ENST00000369899 // intron // 0 // Hs.404089 // SUFU // 51684 // suppressor of fused homolog (Drosophila) /// ENST00000369902 // intron // 0 // Hs.404089 // SUFU // 51684 // suppressor of fused homolog (Drosophila) /// ENST00000423559 // intron // 0 // Hs.404089 // SUFU // 51684 // suppressor of fused homolog (Drosophila) /// ENST00000471000 // intron // 0 // Hs.404089 // SUFU // 51684 // suppressor of fused homolog (Drosophila) /// NM_001178133 // intron // 0 // Hs.404089 // SUFU // 51684 // suppressor of fused homolog (Drosophila) /// NM_016169 // intron // 0 // Hs.404089 // SUFU // 51684 // suppressor of fused homolog (Drosophila) 607035 // Medulloblastoma, desmoplastic // 155255 // intron /// 607035 // {Meningioma, familial, susceptibility to} // 607174 // intron dbSNP RS ID: rs193256295
S-tag000017 rs9379692 6 24809771 - reverse 0 0 p22.3 ACGAAGAACTGATCAGTGTC[C/T]ATCTCACCCCAACTCCTTG T C YES 6 3 A // 19.0000 /// local // 0.4140 Variation_36499 // 6:24774149-24824012 // Paired End Mapping // 18451855 // Kidd et al. (2008) // CopyNumber deCODE // 48.8012 // 53.4032 // 44.1998 /// Marshfield // 42.2127 // 46.5627 // 38.0244 /// SLM1 // 47.8161 // 50.7322 // 46.4768 D6S2297 // downstream // 38079 /// D6S2235 // upstream // 27176 ENST00000259698 // intron // 0 // Hs.559459 // FAM65B // 9750 // family with sequence similarity 65, member B /// ENST00000538035 // intron // 0 // Hs.559459 // FAM65B // 9750 // family with sequence similarity 65, member B /// NM_014722 // intron // 0 // Hs.559459 // FAM65B // 9750 // family with sequence similarity 65, member B --- dbSNP RS ID: rs9379692
S-tag000020 rs11133011 4 174580215 + same 0 0 q34.1 AGAAGGACGTTCTATAATCTCT[C/T]ACTGCATGCAGACATAAAGC T C YES 6 3 A // 17.0000 /// local // 0.3905 --- deCODE // 168.1134 // 220.2100 // 116.0269 /// Marshfield // 175.0634 // 233.2754 // 117.6400 /// SLM1 // 167.3463 // 215.4463 // 121.2000 D4S3234 // downstream // 6793 /// D4S2343 // upstream // 124252 ENST00000413691 // upstream // 24693 // --- // --- // --- // --- /// ENST00000515825 // downstream // 218407 // --- // --- // --- // --- /// NM_012180 // downstream // 577595 // Hs.76917 // FBXO8 // 26269 // F-box protein 8 /// NR_003679 // downstream // 117234 // --- // NBLA00301 // 79804 // Nbla00301 --- dbSNP RS ID: rs11133011
S-tag000026 rs1274264 3 114353990 + same 0 0 q13.31 CTGAGGGATAGTTAGCAAAAA[A/C]TAAAAGGAGCAGGCATCC A C YES 6 3 A // 17.0000 /// local // 0.3652 --- deCODE // 122.1371 // 154.2233 // 90.0581 /// Marshfield // 129.0749 // 156.3710 // 102.0892 /// SLM1 // 117.4833 // 133.8237 // 102.0000 D3S2767E // downstream // 51920 /// D3S3526 // upstream // 131248 ENST00000357258 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// ENST00000462705 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// ENST00000463890 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// ENST00000464560 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// ENST00000471418 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// ENST00000479879 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// ENST00000480832 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// ENST00000491500 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// ENST00000492665 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// NM_001164343 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// NM_001164344 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// NM_001164345 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 /// NM_015642 // intron // 0 // Hs.655108 // ZBTB20 // 26137 // zinc finger and BTB domain containing 20 --- dbSNP RS ID: rs1274264
S-tag000028 rs10165364 2 213398277 - reverse 0 0 q34 GTTTCCTGAAACTGTATGTCTT[C/T]AACATAATTTGAGGGAGACTTTA T C --- 6 0 A // 15.0000 /// local // 0.3518 --- deCODE // 208.7744 // 271.4507 // 146.1057 /// Marshfield // 208.4201 // 266.9680 // 150.1500 /// SLM1 // 194.9766 // 233.9101 // 155.6956 D2S1749 // downstream // 649008 /// D2S317 // upstream // 103277 ENST00000260943 // intron // 0 // Hs.390729 // ERBB4 // 2066 // v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) /// ENST00000342788 // intron // 0 // Hs.390729 // ERBB4 // 2066 // v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) /// ENST00000402597 // intron // 0 // Hs.390729 // ERBB4 // 2066 // v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) /// ENST00000436443 // intron // 0 // Hs.390729 // ERBB4 // 2066 // v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) /// ENST00000484594 // intron // 0 // Hs.390729 // ERBB4 // 2066 // v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) /// NM_001042599 // intron // 0 // Hs.390729 // ERBB4 // 2066 // v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) /// NM_005235 // intron // 0 // Hs.390729 // ERBB4 // 2066 // v-erb-a erythroblastic leukemia viral oncogene homolog 4 (avian) --- dbSNP RS ID: rs10165364
S-tag000029 rs357210 1 72025716 - reverse 0 0 p31.1 TCTGTGTAGTTGACAATCATGT[A/G]CACTAGACTTCAAGTGAAGATG A G YES 6 3 A // 17.0000 /// local // 0.3589 --- deCODE // 99.1537 // 128.9413 // 69.3583 /// Marshfield // 100.1804 // 134.4389 // 66.3000 /// SLM1 // 91.4481 // 109.2963 // 73.3481 D80032 // downstream // 157091 /// D1S224 // upstream // 114470 ENST00000306821 // intron // 0 // Hs.146542 // NEGR1 // 257194 // neuronal growth regulator 1 /// ENST00000357731 // intron // 0 // Hs.146542 // NEGR1 // 257194 // neuronal growth regulator 1 /// ENST00000434200 // intron // 0 // Hs.146542 // NEGR1 // 257194 // neuronal growth regulator 1 /// NM_173808 // intron // 0 // Hs.146542 // NEGR1 // 257194 // neuronal growth regulator 1 --- dbSNP RS ID: rs357210
S-tag000031 rs17807807 11 84291404 - reverse 0 0 q14.1 CTGTAAGTACAAGTCAAAGAGT[C/T]AGCAATTTGTTTGGAGACTG T C YES 6 3 A // 16.0000 /// local // 0.3658 --- deCODE // 89.9646 // 120.6258 // 59.3015 /// Marshfield // 86.9967 // 105.2569 // 67.4000 /// SLM1 // 76.9340 // 97.3055 // 57.3000 D11S4135 // downstream // 30417 /// D11S1207 // upstream // 1574 ENST00000376104 // intron // 0 // Hs.367656 // DLG2 // 1740 // discs, large homolog 2 (Drosophila) /// ENST00000398309 // intron // 0 // Hs.367656 // DLG2 // 1740 // discs, large homolog 2 (Drosophila) /// ENST00000524982 // intron // 0 // Hs.367656 // DLG2 // 1740 // discs, large homolog 2 (Drosophila) /// ENST00000527088 // intron // 0 // Hs.367656 // DLG2 // 1740 // discs, large homolog 2 (Drosophila) /// ENST00000529111 // intron // 0 // Hs.367656 // DLG2 // 1740 // discs, large homolog 2 (Drosophila) /// ENST00000532653 // intron // 0 // Hs.367656 // DLG2 // 1740 // discs, large homolog 2 (Drosophila) /// ENST00000543673 // intron // 0 // Hs.367656 // DLG2 // 1740 // discs, large homolog 2 (Drosophila) /// ENST00000546021 // intron // 0 // Hs.367656 // DLG2 // 1740 // discs, large homolog 2 (Drosophila) /// NM_001142699 // intron // 0 // Hs.367656 // DLG2 // 1740 // discs, large homolog 2 (Drosophila) /// NM_001364 // intron // 0 // Hs.367656 // DLG2 // 1740 // discs, large homolog 2 (Drosophila) --- dbSNP RS ID: rs17807807
S-tag000034 rs4789412 17 75071134 + same 0 0 q25.2 AGAGTCACTGCAAGATCAC[A/G]TTTGGGAGGATGGGAATTTATC A G YES 6 3 A // 18.0000 /// local // 0.5035 --- deCODE // 117.3484 // 151.0180 // 83.6789 /// Marshfield // 104.6598 // 136.4455 // 73.9948 /// SLM1 // 101.0494 // 120.8494 // 82.9224 D17S2241 // downstream // 43813 /// D17S2242 // upstream // 53284 ENST00000366146 // downstream // 5584 // --- // --- // --- // --- /// ENST00000428789 // downstream // 124669 // Hs.144531 // MGAT5B // 146664 // mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B /// NM_198955 // downstream // 124663 // Hs.144531 // MGAT5B // 146664 // mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase, isozyme B /// NR_027058 // upstream // 13591 // --- // LINC00338 // 654434 // long intergenic non-protein coding RNA 338 --- dbSNP RS ID: rs4789412
S-tag000035 rs10951343 7 32634796 + same 0 0 p14.3 GTGCAGAGTAAGCACTTAG[C/T]GGACACTGGATGAATAGACCG T C YES 6 3 A // 20.0000 /// local // 0.4077 --- deCODE // 53.1720 // 61.9918 // 44.3437 /// Marshfield // 50.6504 // 54.7401 // 46.7007 /// SLM1 // 44.9255 // 50.9000 // 38.7509 D7S1655 // downstream // 7558 /// D7S3239 // upstream // 15574 ENST00000404479 // intron // 0 // Hs.128056 // AVL9 // 23080 // AVL9 homolog (S. cerevisiase) /// NR_036680 // intron // 0 // --- // DPY19L1P1 // 100129460 // dpy-19-like 1 pseudogene 1 (C. elegans) --- dbSNP RS ID: rs10951343
S-tag000036 rs9454688 6 69796984 - reverse 0 0 q12 AGTGTAGGCTCAAGTTAGAA[A/C]GTGTAAAGGATCTATATGTGTGT A C YES 6 3 A // 16.0000 /// local // 0.3528 --- deCODE // 83.8107 // 108.2814 // 59.3400 /// Marshfield // 83.1762 // 109.6708 // 57.6894 /// SLM1 // 80.3987 // 97.0000 // 64.4127 D6S965 // downstream // 47133 /// D6S467 // upstream // 128319 ENST00000370598 // intron // 0 // Hs.13261 // BAI3 // 577 // brain-specific angiogenesis inhibitor 3 /// NM_001704 // intron // 0 // Hs.13261 // BAI3 // 577 // brain-specific angiogenesis inhibitor 3 --- dbSNP RS ID: rs9454688

Total number of rows: 239038

Table truncated, full table size 254831 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap