NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL20144 Query DataSets for GPL20144
Status Public on May 05, 2015
Title Agilent-027438 Yeast S-Y SNP v1 [Probe Name Version]
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Saccharomyces cerevisiae
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
 
Description Whole genome SNPs between S288c and YJM789. Both Watson and Crick strands represented as well as both probes specific to both strains.

In the labels of the oligonucleotides 'SF', 'SR', 'YF' and 'YR' refer to the orientation and origin of the sequences used for the oligonucleotides on the microarrays. 'S' and 'Y' indicate whether the oligonucleotide contains sequences identical to the reference S288c genome (closely related to W303-1A) or the YJM789 genome, respectively. 'F' and 'R' indicate whether the orientation (5' to 3') is identical to the orientation in SGD ('F' standing for forward) or opposite to that shown in SGD ('R' for reverse). Thus, 'F' and 'R' have the sequences of the complementary Watson and Crick strands at each position. For all oligonucleotides for a particular SNP, the number used to label the coordinate is the coordinate of the first base of the oligonucleotide in the 'F' orientation. In addition, the oligonucleotides for the YJM789-derived sequences were labeled with the same coordinate as the S288c-derived sequences. The sequence information for the YJM789 sequences was from SGD based on the paper by (Wei et al., 2007. PNAS 104:12825-12830).

Arrays of this design have barcodes that begin with 16027438 or 2527438.

Orientation:
Features are numbered numbered Left-to-Right, Top-to-Bottom as scanned by an Agilent scanner (barcode on the left, DNA on the back surface, scanned through the glass), matching the FeatureNum output from Agilent's Feature Extraction software.

The ID column represents the Agilent Feature Extraction feature number.

Rows and columns are numbered as scanned by an Axon Scanner (barcode on the bottom, DNA on the front surface).

To match data scanned on an Axon scanner, use the RefNumber column contained in the Agilent-provided GAL file as the ID_REF column in sample submissions.
 
Citation(s) 22267500
Submission date May 04, 2015
Last update date May 05, 2015
Contact name Thomas D Petes
E-mail(s) tom.petes@duke.edu
Phone 919 684-4986
Organization name Duke University School of Medicine
Department Molecular Genetics and Microbiology
Lab Petes
Street address 213 Research Drive
City Durham
State/province NC
ZIP/Postal code 27710
Country USA
 
Samples (367) GSM2079625, GSM2079626, GSM2079627, GSM2079628, GSM2079629, GSM2079630 
Series (13)
GSE78856 Genomic instability induced by lowered expression of POL3 in yeast
GSE97667 Effectes of temperatures on meiotic recombination in S. cerevisiae
GSE100497 High-resolution mapping of heteroduplex DNA formed in UV-induced and spontaneous mitotic recombination events in yeast
Relations
Alternative to GPL20143 (Feature Number Version)

Data table header descriptions
ID Agilent Probe Name
CONTROL_TYPE Control type
ACCESSION_STRING strain
CHROMOSOMAL_LOCATION Chromosomal Location
SEQUENCE
SPOT_ID Spot identifier

Data table
ID CONTROL_TYPE ACCESSION_STRING CHROMOSOMAL_LOCATION SEQUENCE SPOT_ID
DarkCorner pos DarkCorner
chr1:101460YR FALSE YJM789 chr1:101460-101484 AGATGGAGCATATATACATGTTTTT chr1:101460YR
chr12:815975SR FALSE s288c chr12:815975-815999 GCTCGCAACTATCTAGCTAAATTAA chr12:815975SR
chr10:122055YR FALSE YJM789 chr10:122055-122079 CCTTTAATATATACATTAGGACTGG chr10:122055YR
chr12:301166SR FALSE s288c chr12:301166-301190 GGATAAGCATGCACTAGAATATGTA chr12:301166SR
chr4:127843YF FALSE YJM789 chr4:127843-127867 ATTACTCAAGTTCACGTGTAATGCG chr4:127843YF
chr16:380791SR FALSE s288c chr16:380791-380815 ATCAAATGTTAAAGGAATGAACCAG chr16:380791SR
chr10:342462YF FALSE YJM789 chr10:342462-342486 CATTCCCTGCCCATATTTTAAGCAC chr10:342462YF
chr4:971858SR FALSE s288c chr4:971858-971882 GTGGTTAAAGATACTAAGCTTGTCG chr4:971858SR
chr16:647706SF FALSE s288c chr16:647706-647730 CAGGATCGAAAATTCAAAACAGCAT chr16:647706SF
chr13:880223SF FALSE s288c chr13:880223-880247 AAAACGCATAATGGAATGAAGACTT chr13:880223SF
chr12:1020126YR FALSE YJM789 chr12:1020126-1020150 ATGTGACGATTGGAGAGCAAATAAA chr12:1020126YR
chr1:99918SF FALSE s288c chr1:99918-99942 ACCTTTACCTCAATAATCCCGTAAT chr1:99918SF
chr13:708656YF FALSE YJM789 chr13:708656-708680 AACCAAATTAACAATGTTGAAGATT chr13:708656YF
chr10:661351SF FALSE s288c chr10:661351-661375 TATTTGTGCCTGGATTGAAATTGAT chr10:661351SF
YF1254738 FALSE YJM789 chr4:1254738-1254762 YF1254738
chr12:960122YR FALSE YJM789 chr12:960122-960146 AGAAATGGTGGGTTTTGTAAATTTT chr12:960122YR
chr4:1058614SR FALSE s288c chr4:1058614-1058638 CTTTTTGACTGTGCTTTCAACTTTT chr4:1058614SR
chr4:1231783YF FALSE YJM789 chr4:1231783-1231807 CGCATAAATGGTGCATTTACAAGTT chr4:1231783YF
chr3:236772YF FALSE YJM789 chr3:236772-236796 GGGTTTTTTTTTTCCTCTATAGCTG chr3:236772YF

Total number of rows: 72401

Table truncated, full table size 5684 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap