NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL7305 Query DataSets for GPL7305
Status Public on Sep 16, 2008
Title IMB yeast 7K operon oligo array
Technology type spotted oligonucleotide
Distribution non-commercial
Organism Saccharomyces cerevisiae
Manufacturer Microarray Core Facility of the Institute of Molecular Biology, Academia Sinica, TW
Manufacture protocol Arrays were printed by standard protocols on CodeLink Activated slides ( GE Healthcare) using a Gene Machine(San Carlos, CA) OmniGrid 100 Instrument.
Support glass
Coating other
 
 
Contributor(s) Tung SY
Submission date Sep 13, 2008
Last update date Jan 18, 2013
Contact name Jun-Yi Leu
E-mail(s) jleu@imb.sinica.edu.tw
Organization name Academia Sinica
Department Insititute of Molecular Biolody
Street address 128 Academia Road, Section 2, Nankang
City Taipei
ZIP/Postal code 115
Country Taiwan
 
Samples (52) GSM320519, GSM320520, GSM320521, GSM320522, GSM320523, GSM320524 
Series (5)
GSE12775 Karyotype analysis of S. cerevisiae chromosome replacement lines - a-type cells
GSE12776 Karyotype analysis of S. cerevisiae chromosome replacement lines - alpha-type cells
GSE12785 Karyotype analysis of S. cerevisiae chromosome replacement lines

Data table header descriptions
ID
oligo_id
oligo_type
CGH_xhyb
ORF ORF Name
SEQUENCE
standard_name
SGD_id
status
description
GB_Accession_No
chromosome
PROTEIN_ID of CDS
SPOT_ID

Data table
ID oligo_id oligo_type CGH_xhyb ORF SEQUENCE standard_name SGD_id status description GB_Accession_No chromosome PROTEIN_ID of CDS SPOT_ID
1 Q0010_01 - - Q0010 ATATTTATATTATATAATTAATTATATCGTTTATACTCCTTCGGGGTCCCCGCCGGGGCGGGGACTTTAT Q0010 S000007257 Dubious ORF Dubious mitochondrial open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the dubious ORF Q0017 - Mito -
2 Q0017_01 Predict_CGH_oligo 67.14285714 Q0017 CGTCTCCGAGGTCCCGGTTTCGTAAGAAACCGGGACTTATATATTTATAAATATAAATCTAACTTAATTA Q0017 S000007258 Dubious ORF Dubious mitochondrial open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the dubious ORF Q0010 - Mito -
3 Q0032_01 Predict_CGH_oligo 48.86363636 Q0032 CTATCCTATATTATCCTATCATATAATATCATATCATATTATATTATATCTTATTATATGATATATAAAGTATTCACTCTATATGAGG Q0032 S000007259 Dubious ORF Hypothetical protein - Mito -
4 Q0045_01 Predict_CGH_oligo 21.42857143 Q0045 ATGTATTATCAATGGGTGCTATTTTCTCTTTATTTGCAGGATACTATTATTGAAGTCCTCAAATTTTAGG COX1 S000007260 Verified ORF Subunit I of cytochrome c oxidase, which is the terminal member of the mitochondrial inner membrane electron transport chain; one of three mitochondrially-encoded subunits - Mito -
5 Q0050_01 Predict_CGH_oligo 30 Q0050 GTAACTGATCCTTTTGAATATATCGATTCAATTAAATATATATTACCTACAGCTAAAGCTAATTTTAATA AI1 S000007261 Verified ORF Reverse transcriptase required for splicing of the COX1 pre-mRNA, encoded by a mobile group II intron within the mitochondrial COX1 gene L36897 Mito AAA67532.1
6 Q0055_01 Predict_CGH_oligo - Q0055 GAAAGTTATTTTAAAATTCGGTAAAGTATTAGTTGATCCTCATTCAAAAGTTAGTTTTAGTATTGATGAT AI2 S000007262 Verified ORF Reverse transcriptase required for splicing of the COX1 pre-mRNA, encoded by a mobile group II intron within the mitochondrial COX1 gene - Mito -
7 Q0060_01 Predict_CGH_oligo - Q0060 TAAATGGTAAAAATCGTTCTAGTAGAGCAATGCCTTATTATTGTTTAGAATTAAGACAAAATTATCAAAA AI3 S000007263 Verified ORF Endonuclease I-SceIII, encoded by a mobile group I intron within the mitochondrial COX1 gene - Mito -
8 Q0065_01 Predict_CGH_oligo 38.57142857 Q0065 TGTTGGATTTTTTGATGCTGATGGTACAATTAATTATTCATTTAAAAATAATCATCCTCAATTAACAATT AI4 S000007264 Verified ORF Endonuclease I-SceII, encoded by a mobile group I intron within the mitochondrial COX1 gene; intron is normally spliced by the BI4p maturase but AI4p can mutate to acquire the same maturase activity - Mito -
9 Q0070_01 Predict_CGH_oligo 21.42857143 Q0070 ATATGTGATGGTTCATTTGTAAAAGGTGGAGGTTTATATTTAAATTTACAATCTTTTCTAACTAAAGAAT AI5_ALPHA S000007265 Verified ORF Endonuclease I-SceIV, involved in intron mobility; encoded by a mobile group I intron within the mitochondrial COX1 gene - Mito -
10 Q0075_01 Predict_CGH_oligo 20 Q0075 GTATTTTAAAAAGAGATTATAAATCTGGTGCTACAGCTTATATTTATAAAGCTCAATCATCAAAAGCTAT AI5_BETA S000007266 Uncharacterized ORF Protein of unknown function, encoded within an intron of the mitochondrial COX1 gene; translational initiation codon is predicted to be ATA rather than ATG - Mito -
11 Q0080_01 Predict_CGH_oligo 18.75 Q0080 GGTTTCTTATTAATGATTCTATTATTAATTTTATTCTCACAATTCTTTTTACCTATGATCTTAAGATTATATGTATCTAG ATP8 S000007267 Verified ORF Subunit 8 of the F0 sector of mitochondrial inner membrane F1-F0 ATP synthase, encoded on the mitochondrial genome - Mito -
12 Q0085_01 Predict_CGH_oligo - Q0085 AGGTTCTAATATCTTAGCTGGTCATTTATTAATGGTTATTTTAGCTGGTTTACTATTTAATTTTATGTTA ATP6 S000007268 Verified ORF Mitochondrially encoded subunit 6 of the F0 sector of mitochondrial F1F0 ATP synthase, which is a large, evolutionarily conserved enzyme complex required for ATP synthesis J01464|L36897|M36379|V00683|X05056 Mito AAA32145.2|AAA32149.2|AAA67534.1|CAA24054.1|CAA28727.1
13 Q0092_01 Predict_CGH_oligo 42.85714286 Q0092 ATATTCATTATATTTATAATTATATATAATGTAATACGGGTAAACATTACCCGTTGTTCACGGGTAATGT Q0092 S000007269 Dubious ORF Hypothetical protein - Mito -
14 Q0105_01 - - Q0105 TCACCTAATACTTTAGGTCATCCTGATAACTATATTCCTGGTAATCCTTTAGTAACACCAGCATCTATTG COB S000007270 Verified ORF Cytochrome b, mitochondrially encoded subunit of the ubiquinol-cytochrome c reductase complex which includes Cobp, Rip1p, Cyt1p, Cor1p, Qcr2p, Qcr6p, Qcr7p, Qcr8p, Qcr9p, and Qcr10p - Mito -
15 Q0110_01 Predict_CGH_oligo 34.28571429 Q0110 TTAGCTTTAGCTATTTGAATTATAGATGATGGATGTAAATTAGGTAAAGGTTTAAAATTCACAACTAATT BI2 S000007271 Verified ORF Mitochondrial mRNA maturase with a role in splicing, encoded by both exon and intron sequences of partially processed COB mRNA - Mito -
16 Q0115_01 Predict_CGH_oligo 32.85714286 Q0115 GCTGAAAGTTGTTTTAGTATTTATAAACCTATAAATAAAAAAATAAAACTTGCTAGTTTTGAAGTATCTC BI3 S000007272 Verified ORF Mitochondrial mRNA maturase, forms a complex with Mrs1p to mediate splicing of the bI3 intron of the COB gene; encoded by both exon and intron sequences of partially processed COB mRNA - Mito -
17 Q0120_01 Predict_CGH_oligo 52.85714286 Q0120 AAATTAGACCTCAATTAACTATTAGCGTTACAAATAAATATTTACATGATGTTGAATACTATAGAGAAGT BI4 S000007273 Verified ORF Mitochondrial mRNA maturase, forms a complex with Nam2p to mediate splicing of the bI4 intron of the COB gene; encoded by both exon and intron sequences of partially processed COB mRNA - Mito -
18 Q0130_01 Predict_CGH_oligo - Q0130 TCAAGAAACCCATCAATTAAAGACCTAGTATTCCCTATGGCTATTTTAGGTTTCGCCTTATCAGAAGCTA OLI1 S000007274 Verified ORF F0-ATP synthase subunit 9 (ATPase-associated proteolipid), encoded on the mitochondrial genome; mutation confers oligomycin resistance; expression is specifically dependent on the nuclear genes AEP1 and AEP2 J01462|L00007|L36899|V00707|X03968|X05357|X05358 Mito AAA32146.1|AAA32169.1|AAA67535.1|CAA24079.1|CAA27605.1|CAA28961.1|CAA28962.1
19 Q0140_01 Predict_CGH_oligo - Q0140 GTTGGTTGATCTATTAAATTTAAAGGTAGATTAAGTAATAATAATGGTAGAACTAGTACACTTAATTTAT VAR1 S000007275 Verified ORF Mitochondrial ribosomal protein of the small subunit, mitochondrially-encoded; polymorphic in different strains due to variation in number of AAT (asparagine) codons; translated near the mitochondrial inner membrane V00705 Mito CAA24077.1
20 Q0142_01 Predict_CGH_oligo 48.57142857 Q0142 GTTCCGGAACTCCTCCTTCTCGCGAGGTTAACACCTATTATATAACTATAACTATAACTATAACTATAAT Q0142 S000007276 Dubious ORF Hypothetical protein - Mito -

Total number of rows: 6400

Table truncated, full table size 2100 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap