GEO Profile Links for Gene (Select 22152) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 293830091.

Tubb3 - Embryonic stem cell line response to the conditional expression of neurogenin 3

Annotation:: Tubb3, tubulin, beta 3 class III

Organism:: Mus musculus

Reporter:: GPL1261, 1415978_at (ID_REF), GDS2276, 22152 (Gene ID), NM_023279

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 29383009

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 54164272.

Tubb3 - Down syndrome and brain (MG-U74A)

Annotation:: Tubb3, tubulin, beta 3 class III

Organism:: Mus musculus

Reporter:: GPL81, 160462_f_at (ID_REF), GDS681, 22152 (Gene ID), AW050256

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 5416427

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 404796273.

Tubb3 - Nuclear factor I-A deficiency effect on brain development

Annotation:: Tubb3, tubulin, beta 3 class III

Organism:: Mus musculus

Reporter:: GPL81, 160462_f_at (ID_REF), GDS2775, 22152 (Gene ID), AW050256

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 40479627

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 404807774.

Tubb3 - Nuclear factor I-A deficiency effect on brain development

Annotation:: Tubb3, tubulin, beta 3 class III

Organism:: Mus musculus

Reporter:: GPL81, 161612_f_at (ID_REF), GDS2775, 22152 (Gene ID), AV350617

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 40480777

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 169924275.

Tubb3 - Nodose and dorsal root ganglia comparison (MG-U74A)

Annotation:: Tubb3, tubulin, beta 3 class III

Organism:: Mus musculus

Reporter:: GPL81, 160462_f_at (ID_REF), GDS1634, 22152 (Gene ID), AW050256

DataSet type:: Expression profiling by array, count, 22 samples

ID:: 16992427

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 214327656.

Tubb3 - Integrin beta-6 deficiency model of emphysema: alveolar macrophage

Annotation:: Tubb3, tubulin, beta 3 class III

Organism:: Mus musculus

Reporter:: GPL1792, M200008247 (ID_REF), GDS1874, NM_023279

DataSet type:: Expression profiling by array, log ratio, 15 samples

ID:: 21432765

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 91167097.

Tubb3 - Hypoxic-ischemic injury response to erythropoietin pretreatment

Annotation:: Tubb3, tubulin, beta 3 class III

Organism:: Mus musculus

Reporter:: GPL1261, 1415978_at (ID_REF), GDS1017, 22152 (Gene ID), NM_023279

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 9116709

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 753553608.

Tubb3 - BKS db/db model of type 2 diabetes: sciatic nerve

Annotation:: Tubb3, tubulin, beta 3 class III

Organism:: Mus musculus

Reporter:: GPL9746, 22152_at (ID_REF), GDS3993, 22152 (Gene ID)

DataSet type:: Expression profiling by array, transformed count, 13 samples

ID:: 75355360

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 170014099.

Tubb3 - Nodose and dorsal root ganglia comparison (MG-430 2.0)

Annotation:: Tubb3, tubulin, beta 3 class III

Organism:: Mus musculus

Reporter:: GPL1261, 1415978_at (ID_REF), GDS1635, 22152 (Gene ID), NM_023279

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 17001409

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6568970910.

Tubb3 - Zinc finger Zbtb20 deficiency effect on the developing hippocampus

Annotation:: Tubb3, tubulin, beta 3 class III

Organism:: Mus musculus

Reporter:: GPL1261, 1415978_at (ID_REF), GDS3718, 22152 (Gene ID), NM_023279

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 65689709

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 474962711.

Tubb3 - Neurofibromatosis and neurodevelopment

Annotation:: Tubb3, tubulin, beta 3 class III

Organism:: Mus musculus

Reporter:: GPL81, 160462_f_at (ID_REF), GDS604, 22152 (Gene ID), AW050256

DataSet type:: Expression profiling by array, count, 30 samples

ID:: 4749627

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 753377712.

Tubb3 - MPSS transcriptome analysis project

Annotation:: Tubb3, tubulin, beta 3 class III

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCCAACAACGTCAAGG (ID_REF), GDS868, NM_023279

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7533777

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12442470913.

Tubb3 - Neuron-specific T-box transcription factor deficiency effect on embryonic day 16.5 forebrains

Annotation:: Tubb3, tubulin, beta 3 class III

Organism:: Mus musculus

Reporter:: GPL1261, 1415978_at (ID_REF), GDS5389, 22152 (Gene ID), NM_023279

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 124424709

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12689400914.

Tubb3 - Onecut1 deficiency effect on embryonic E14.5 retina

Annotation:: Tubb3, tubulin, beta 3 class III

Organism:: Mus musculus

Reporter:: GPL1261, 1415978_at (ID_REF), GDS5458, 22152 (Gene ID), NM_023279

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 126894009

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 891472715.

Tubb3 - Segmental trisomy Ts1Cje model for Down syndrome

Annotation:: Tubb3, tubulin, beta 3 class III

Organism:: Mus musculus

Reporter:: GPL81, 160462_f_at (ID_REF), GDS994, 22152 (Gene ID), AW050256

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 8914727

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1728512716.

Tubb3 - POU-domain transcription factor Brn3a knockout effect on embryonic ganglia (MG-U74A)

Annotation:: Tubb3, tubulin, beta 3 class III

Organism:: Mus musculus

Reporter:: GPL81, 160462_f_at (ID_REF), GDS1651, 22152 (Gene ID), AW050256

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 17285127

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1908732717.

Tubb3 - Succinate semialdehyde dehydrogenase deficiency effect on the brain

Annotation:: Tubb3, tubulin, beta 3 class III

Organism:: Mus musculus

Reporter:: GPL81, 160462_f_at (ID_REF), GDS1745, 22152 (Gene ID), AW050256

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 19087327

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4446362718.

Tubb3 - Neural retina leucine zipper deficiency effect on retinas: time course

Annotation:: Tubb3, tubulin, beta 3 class III

Organism:: Mus musculus

Reporter:: GPL81, 160462_f_at (ID_REF), GDS2936, 22152 (Gene ID), AW050256

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 44463627

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12547330919.

Tubb3 - Embryonic lung and brain cortex: endothelial cells

Annotation:: Tubb3, tubulin, beta 3 class III

Organism:: Mus musculus

Reporter:: GPL1261, 1415978_at (ID_REF), GDS5417, 22152 (Gene ID), NM_023279

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 125473309

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1535042720.

Tubb3 - Neonatal brains from X-monosomic females

Annotation:: Tubb3, tubulin, beta 3 class III

Organism:: Mus musculus

Reporter:: GPL81, 160462_f_at (ID_REF), GDS1513, 22152 (Gene ID), AW050256

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 15350427

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 22152) (1000)
GEO Profiles
BioAssay, by Gene target for Gene (Select 381438) (0)
PubChem BioAssay
Gene neighbors for Gene (Select 381438) (11)
Gene
PMC Links for GEO Profiles (Select 125866126) (19)
PMC
Mus musculus
Mus musculus

Genome

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity