GEO Profile Links for Gene (Select 66990) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 149318361.

Tmem134 - Growth hormone effect on adipocytes: time course

Annotation:: Tmem134, transmembrane protein 134

Organism:: Mus musculus

Reporter:: GPL81, 95090_at (ID_REF), GDS1489, 66990 (Gene ID), AA688600

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 14931836

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 132060362.

Tmem134 - Peripheral myelin protein 22 gene dosage and point mutation effect on sciatic nerve

Annotation:: Tmem134, transmembrane protein 134

Organism:: Mus musculus

Reporter:: GPL81, 95090_at (ID_REF), GDS1371, 66990 (Gene ID), AA688600

DataSet type:: Expression profiling by array, count, 21 samples

ID:: 13206036

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 260215473.

Tmem134 - Brown fat cell response to PGC-1alpha and PGC-1beta deficiency

Annotation:: Tmem134, transmembrane protein 134

Organism:: Mus musculus

Reporter:: GPL1261, 1455752_a_at (ID_REF), GDS2123, 66990 (Gene ID), BF681820

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 26021547

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 317284474.

Tmem134 - B cell-activating factor of the TNF family effect on B cells

Annotation:: Tmem134, transmembrane protein 134

Organism:: Mus musculus

Reporter:: GPL1261, 1455752_a_at (ID_REF), GDS2408, 66990 (Gene ID), BF681820

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 31728447

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 59552675.

Tmem134 - High fat diet effect on aorta: time course

Annotation:: Tmem134, transmembrane protein 134

Organism:: Mus musculus

Reporter:: GPL891, 5967 (ID_REF), GDS735, NM_025889, A_51_P472538 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 54 samples

ID:: 5955267

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 52090366.

Tmem134 - Thymocyte selection by agonist

Annotation:: Tmem134, transmembrane protein 134

Organism:: Mus musculus

Reporter:: GPL81, 95090_at (ID_REF), GDS658, 66990 (Gene ID), AA688600

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 5209036

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 105848367.

Tmem134 - White adipose tissue remodeling: response to β3-adrenergic receptor activation

Annotation:: Tmem134, transmembrane protein 134

Organism:: Mus musculus

Reporter:: GPL81, 95090_at (ID_REF), GDS1225, 66990 (Gene ID), AA688600

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 10584836

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 953896478.

Tmem134 - Pristane-induced plasmacytoma tumor model: time course

Annotation:: Tmem134, transmembrane protein 134

Organism:: Mus musculus

Reporter:: GPL1261, 1455752_a_at (ID_REF), GDS4189, 66990 (Gene ID), BF681820

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 95389647

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1209861839.

Tmem134 - Maternal western diet effect on post-weaning western diet fed offspring liver

Annotation:: Tmem134, transmembrane protein 134

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2773422 (ID_REF), GDS5293, NM_001078649, TMEM134 (ORF)

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 120986183

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1189564710.

Tmem134 - Aldosterone effect on heart: time course

Annotation:: Tmem134, transmembrane protein 134

Organism:: Mus musculus

Reporter:: GPL1261, 1455752_a_at (ID_REF), GDS1303, 66990 (Gene ID), BF681820

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 11895647

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4130854711.

Tmem134 - Brown and white adipose tissues

Annotation:: Tmem134, transmembrane protein 134

Organism:: Mus musculus

Reporter:: GPL1261, 1455752_a_at (ID_REF), GDS2813, 66990 (Gene ID), BF681820

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41308547

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 594523612.

Tmem134 - Thiazolidinedione treatment of 3T3-L1 adipocytes

Annotation:: Tmem134, transmembrane protein 134

Organism:: Mus musculus

Reporter:: GPL81, 95090_at (ID_REF), GDS734, 66990 (Gene ID), AA688600

DataSet type:: Expression profiling by array, count, 11 samples

ID:: 5945236

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 737223613.

Tmem134 - Peroxisome proliferator-activated receptor-gamma target genes in aorta

Annotation:: Tmem134, transmembrane protein 134

Organism:: Mus musculus

Reporter:: GPL81, 95090_at (ID_REF), GDS859, 66990 (Gene ID), AA688600

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 7372236

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 747223914.

Tmem134 - MPSS transcriptome analysis project

Annotation:: Tmem134, transmembrane protein 134

Organism:: Mus musculus

Reporter:: GPL1010, GATCCAAGGCCTCAGGTCAC (ID_REF), GDS868, BC026765

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7472239

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5977914715.

Tmem134 - Skeletal muscle response to myostatin inhibition

Annotation:: Tmem134, transmembrane protein 134

Organism:: Mus musculus

Reporter:: GPL1261, 1455752_a_at (ID_REF), GDS3526, 66990 (Gene ID), BF681820

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 59779147

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10397724716.

Tmem134 - GPR120-deficient white adipose tissue response to a high fat diet

Annotation:: Tmem134, transmembrane protein 134

Organism:: Mus musculus

Reporter:: GPL1261, 1455752_a_at (ID_REF), GDS4811, 66990 (Gene ID), BF681820

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 103977247

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1059773617.

Tmem134 - White adipose tissue remodeling: role of peroxisome proliferator-activated receptor alpha

Annotation:: Tmem134, transmembrane protein 134

Organism:: Mus musculus

Reporter:: GPL81, 95090_at (ID_REF), GDS1226, 66990 (Gene ID), AA688600

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 10597736

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5348684718.

Tmem134 - Fibroblast pseudopodia response to fibronectin

Annotation:: Tmem134, transmembrane protein 134

Organism:: Mus musculus

Reporter:: GPL1261, 1455752_a_at (ID_REF), GDS3288, 66990 (Gene ID), BF681820

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 53486847

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3958756819.

Tmem134 - Wilms' tumor protein Wt1 deficiency effect on the urogenital ridge

Annotation:: Tmem134, transmembrane protein 134

Organism:: Mus musculus

Reporter:: GPL1524, 15768 (ID_REF), GDS2747, NM_025889

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 39587568

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5344034720.

Tmem134 - Fibroblast pseudopodia response to lysophosphatidic acid

Annotation:: Tmem134, transmembrane protein 134

Organism:: Mus musculus

Reporter:: GPL1261, 1455752_a_at (ID_REF), GDS3287, 66990 (Gene ID), BF681820

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 53440347

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 66990) (1000)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity