GEO DataSets

(Submitter supplied) To determine toxicant specific effects of Ordnance Related Compound (ORC) exposure we performed microarray hybridizations with RNA isolated from Daphnia magna following different ORC exposures at the 1/10 LC50. The gene expression profiles revealed toxicant specific gene expression profiles allowed for the identification of specific biomarkers of exposure. Keywords: ecotoxicogenomic exposure study

Organism:

Daphnia magna

Type:

Expression profiling by array

Platforms:

GPL5129 GPL3710

70 Samples

Download data: GPR

(Submitter supplied) The 5000 randomly selected cDNA clones from the Daphnia Genome Consortium (DGC) library were PCR amplified from the pDNR-LIB vector using the following primers: forward: AGTCGACGGTACCGGACATA and reverse: GCCAAACGAATGGTCTAGAAA. An additional 2681 cDNAs were constructed at the US Army Engineer Research and Development Center in Vicksburg, MS. Daphnia magna were exposed to twelve model toxicants for 24 h at the 1/10 LC50 and RNA was isolated using standard protocols for Trizoll (Invitrogen). more...

Organism:

Daphnia magna

4 Series

131 Samples

Download data

(Submitter supplied) The 5000 randomly selected cDNA clones from the Daphnia Genome Consortium (DGC) library (generous gift from D. Bauer at University of New Hampshire, NH and J. Colbourne at Indiana University, IN) were PCR amplified from the pDNR-LIB vector using the following primers: forward: AGTCGACGGTACCGGACATA and reverse: GCCAAACGAATGGTCTAGAAA. PCR products were purified by ethanol precipitation and resuspended in distilled water. more...

Organism:

Daphnia magna

3 Series

83 Samples

Download data