GSM1419309[Accession] - GEO DataSets

Warning: The NCBI web site requires JavaScript to function. more...

Format

Summary
Summary (text)
Unique Identifier List

Sort by

Default order
Number of Samples (High to Low)
Number of Samples (Low to High)

Send to:

Choose Destination

File
Clipboard
Collections

Search results

Items: 3

Select item 2000587781.

Mitochondrial ATP Synthase Subunit d Interacts with TOR Signaling and Dietary Macronutrients to Modulate Proteostasis and Lifespan in Drosophila

(Submitter supplied) Diet composition is a critical determinant of lifespan and nutrient imbalance is detrimental health. However, how nutrients interact with genetic factors to modulate lifespan remains elusive. We investigated how diet composition influences mitochondrial ATP synthase subunit d (ATPsyn-d) in modulating lifespan in Drosophila. ATPsyn-d knockdown extended lifespan in females fed low carbohydrate-to-protein (C:P) diets, but not the high C:P ratio diet. more...

Organism:: Drosophila melanogaster

Type:: Expression profiling by array

Platform:: GPL18860
8 Samples

Download data: TXT

Series

Accession:: GSE58778

ID:: 200058778

PubMed Full text in PMC Similar studies Analyze with GEO2R

Select item 1000188602.

NIA Drosophila microarray

(Submitter supplied) PCR products of 14,151 predicted or known genes in D. melanogaster were used to generate DNA microarray. The length of each PCR amplicon was 100-600 bp. cDNA was amplified with universal primers (AATGCAGGTTAACCTGGCTTATCG and AACGCGGCTACAATTAATACATAACC). PCR products were printed on 3-D slides (Full Moon Biosystems Inc.).