GSM332978[Accession] - GEO DataSets

Warning: The NCBI web site requires JavaScript to function. more...

Format

Summary
Summary (text)
Unique Identifier List

Sort by

Default order
Number of Samples (High to Low)
Number of Samples (Low to High)

Send to:

Choose Destination

File
Clipboard
Collections

Search results

Items: 3

Select item 2000131691.

Gene expression profiling in Daphnia magna, Part III: Uncovering Biomarkers for Metal and ORC exposures

(Submitter supplied) To determine toxicant specific effects of Ordnance Related Compound (ORC) exposure we performed microarray hybridizations with RNA isolated from Daphnia magna following different ORC exposures at the 1/10 LC50. The gene expression profiles revealed toxicant specific gene expression profiles allowed for the identification of specific biomarkers of exposure. Keywords: ecotoxicogenomic exposure study

Organism:: Daphnia magna

Type:: Expression profiling by array

Platforms:: GPL5129 GPL3710
70 Samples

Download data: GPR

Series

Accession:: GSE13169

ID:: 200013169

Select item 1000037102.

Daphnia magna DGC cDNA array ver.1

(Submitter supplied) The 5000 randomly selected cDNA clones from the Daphnia Genome Consortium (DGC) library (generous gift from D. Bauer at University of New Hampshire, NH and J. Colbourne at Indiana University, IN) were PCR amplified from the pDNR-LIB vector using the following primers: forward: AGTCGACGGTACCGGACATA and reverse: GCCAAACGAATGGTCTAGAAA. PCR products were purified by ethanol precipitation and resuspended in distilled water. more...