NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL431 Query DataSets for GPL431
Status Public on Aug 20, 2003
Title Arabidopsis Pilot Genome Tiling Array 1D
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Arabidopsis thaliana
 
Description This set of Affymetrix array tiles 5 Mb the Arabidopsis genome with a 12 bp overlap
using in situ synthesized 25 bp oligonucleotides.
Perfect match and central position mismatch probes were made for these arrays.
The position coordinates in the table refer to the begining of the 2.5 Mb chromosomal fragment that was tiled on the array.
This chip tiles the second half (1.25 MB) of both strands of the 2.5 Mb sequence of Chromosome 2 that was chosen for these pilot arrays.

Features that have no sequence information represent positioning grids/checkerboards or random sequence controls.
 
Contributor(s) Karlin-Neumann G, Theologis A, Ecker J, Davis R
Submission date Aug 20, 2003
Last update date Dec 11, 2007
Contact name Curtis J Palm
E-mail(s) curtis@sequence.stanford.edu
Phone 650-812-1994
Fax 650-812-1975
Organization name Stanford Genome Technology Center
Department
Lab R. W. Davis
Street address 855 California Ave
City Palo Alto
State/province CA
ZIP/Postal code 94304
Country USA
 
Samples (6) GSM9008, GSM9009, GSM9010, GSM9196, GSM9197, GSM9198
Series (6)
GSE601 Identification of new and unpredicted full length Arabidopsis genes
GSE604 Identification of new full length Arabidopsis genes - pilot arrays
GSE636 Expression of Annotated Genes

Data table header descriptions
ID
X location in array
Y location in array
SEQUENCE oligo sequence
DESTYPE description of oligo type, for chromosomal oligos mismatch probes have value of -113, perfect match have a value of -111
Qualifier descriptive name for oligo set
Pos position of oligo in sequence (base 1 of oligo for forward strand oligos, base 25 of oligo for opposite strand oligos)
Unit integer value for Qualifier
Atom integer value, unique for each oligo within a Unit

Data table
ID X Y SEQUENCE DESTYPE Qualifier Pos Unit Atom
1 0 0 GTCGTCAAGATGCTACCGTTCAGGA 3 default_st -1 0 0
2 1 0 TCCTGAACGGTAGCATCTTGACGAC -3 default_at -1 0 0
3 2 0 GTCGTCAAGATGCTACCGTTCAGGA 3 default_st -1 0 0
4 3 0 TCCTGAACGGTAGCATCTTGACGAC -3 default_at -1 0 0
5 4 0 0 default_st -1 0 0
6 5 0 GTCGTCAAGATGCTACCGTTCAGGA 6 default_st -1 0 0
7 6 0 TCCTGAACGGTAGCATCTTGACGAC -6 default_at -1 0 0
8 7 0 GTCGTCAAGATGCTACCGTTCAGGA 6 default_st -1 0 0
9 8 0 TCCTGAACGGTAGCATCTTGACGAC -6 default_at -1 0 0
10 9 0 GTCGTCAAGATGCTACCGTTCAGGA 6 default_st -1 0 0
11 10 0 TCCTGAACGGTAGCATCTTGACGAC -6 default_at -1 0 0
12 11 0 GTCGTCAAGATGCTACCGTTCAGGA 6 default_st -1 0 0
13 12 0 TCCTGAACGGTAGCATCTTGACGAC -6 default_at -1 0 0
14 13 0 GTCGTCAAGATGCTACCGTTCAGGA 6 default_st -1 0 0
15 14 0 TCCTGAACGGTAGCATCTTGACGAC -6 default_at -1 0 0
16 15 0 GTCGTCAAGATGCTACCGTTCAGGA 6 default_st -1 0 0
17 16 0 TCCTGAACGGTAGCATCTTGACGAC -6 default_at -1 0 0
18 17 0 GTCGTCAAGATGCTACCGTTCAGGA 6 default_st -1 0 0
19 18 0 TCCTGAACGGTAGCATCTTGACGAC -6 default_at -1 0 0
20 19 0 GTCGTCAAGATGCTACCGTTCAGGA 6 default_st -1 0 0

Total number of rows: 409600

Table truncated, full table size 34106 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap