GEO Profiles Links for Nucleotide (Select 15012151) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 160

<< First< Prev

Page of 8

Next >Last >>

Select item 76018801.

Galt - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Galt, galactose-1-phosphate uridyl transferase

Organism:: Mus musculus

Reporter:: GPL1010, GATCCGCAACTGTCCGGAAG (ID_REF), GDS878, BC010985

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7601880

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74641802.

Galt - MPSS transcriptome analysis project

Annotation:: Galt, galactose-1-phosphate uridyl transferase

Organism:: Mus musculus

Reporter:: GPL1010, GATCCGCAACTGTCCGGAAG (ID_REF), GDS868, BC010985

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7464180

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1029306923.

Galt - Liver response to a high fat diet: time course

Annotation:: Galt, galactose-1-phosphate uridyl transferase

Organism:: Mus musculus

Reporter:: GPL6246, 10504094 (ID_REF), GDS4783, NM_016658, AK163544, BC010985, M96265, AK088379, AK134525, chr4:41755503-41758682 (SPOT ID)

DataSet type:: Expression profiling by array, count, 36 samples

ID:: 102930692

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1078481924.

Galt - Estrogen effect on male and female haematopoietic stem cells

Annotation:: Galt, galactose-1-phosphate uridyl transferase

Organism:: Mus musculus

Reporter:: GPL6246, 10504094 (ID_REF), GDS4944, NM_016658, AK163544, BC010985, M96265, AK088379, AK134525, chr4:41755503-41758682 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 107848192

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1143635925.

Galt - Regulatory T cell ablation effect on BDC2.5/NOD pancreatic or splenic natural killer cells: time course

Annotation:: Galt, galactose-1-phosphate uridyl transferase

Organism:: Mus musculus

Reporter:: GPL6246, 10504094 (ID_REF), GDS4946, NM_016658, AK163544, BC010985, M96265, AK088379, AK134525, chr4:41755503-41758682 (SPOT ID)

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 114363592

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 61484376.

Il11ra1 - Blastocyst dormancy and activation comparison

Annotation:: Il11ra1, interleukin 11 receptor, alpha chain 1 (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 12137 (ID_REF), GDS752, AK088379, BC010985, U14412, H3135D06-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 6148437

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1144002927.

Galt - Transforming growth factor beta effect on cytokine-activated, NOD-derived, splenic natural killer cells

Annotation:: Galt, galactose-1-phosphate uridyl transferase

Organism:: Mus musculus

Reporter:: GPL6246, 10504094 (ID_REF), GDS4948, NM_016658, AK163544, BC010985, M96265, AK088379, AK134525, chr4:41755503-41758682 (SPOT ID)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 114400292

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1065986928.

Galt - Heart response to isocitrate dehydrogenase 2 mutations IDH2R140Q and IDH2R172K

Annotation:: Galt, galactose-1-phosphate uridyl transferase

Organism:: Mus musculus

Reporter:: GPL6246, 10504094 (ID_REF), GDS4893, NM_016658, AK163544, BC010985, M96265, AK088379, AK134525, chr4:41755503-41758682 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 106598692

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1064360929.

Galt - Histone deacetylase 3 deficiency effect on the heart

Annotation:: Galt, galactose-1-phosphate uridyl transferase

Organism:: Mus musculus

Reporter:: GPL6246, 10504094 (ID_REF), GDS4886, NM_016658, AK163544, BC010985, M96265, AK088379, AK134525, chr4:41755503-41758682 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 106436092

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6665239210.

Galt - Peroxisome proliferator-activated receptor alpha deficiency effect on phthalate-exposed liver

Annotation:: Galt, galactose-1-phosphate uridyl transferase

Organism:: Mus musculus

Reporter:: GPL6246, 10504094 (ID_REF), GDS3748, NM_016658, AK163544, BC010985, M96265, AK088379, AK134525, chr4:41755503-41758682 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 66652392

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11859529211.

Galt - Sarcolipin deficiency effect on heart atrium

Annotation:: Galt, galactose-1-phosphate uridyl transferase

Organism:: Mus musculus

Reporter:: GPL6246, 10504094 (ID_REF), GDS5236, NM_016658, AK163544, BC010985, M96265, AK088379, AK134525, chr4:41755503-41758682 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118595292

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11404859212.

Galt - Synergist ablation effect on young adult plantaris muscle: time course

Annotation:: Galt, galactose-1-phosphate uridyl transferase

Organism:: Mus musculus

Reporter:: GPL6246, 10504094 (ID_REF), GDS4932, NM_016658, AK163544, BC010985, M96265, AK088379, AK134525, chr4:41755503-41758682 (SPOT ID)

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 114048592

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11053639213.

Galt - db/db model of obesity-induced type 2 diabetes: neuroretina

Annotation:: Galt, galactose-1-phosphate uridyl transferase

Organism:: Mus musculus

Reporter:: GPL6246, 10504094 (ID_REF), GDS5041, NM_016658, AK163544, BC010985, M96265, AK088379, AK134525, chr4:41755503-41758682 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 110536392

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7510529214.

Galt - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: Galt, galactose-1-phosphate uridyl transferase

Organism:: Mus musculus

Reporter:: GPL6246, 10504094 (ID_REF), GDS3987, NM_016658, AK163544, BC010985, M96265, AK088379, AK134525, chr4:41755503-41758682 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75105292

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13206379215.

Galt - Nebulin deficiency effect on the soleus

Annotation:: Galt, galactose-1-phosphate uridyl transferase

Organism:: Mus musculus

Reporter:: GPL6246, 10504094 (ID_REF), GDS5881, NM_016658, AK163544, BC010985, M96265, AK088379, AK134525, chr4:41755503-41758682 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 132063792

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11374435616.

Galt - Fasting effect on white adipose tissue, liver and skeletal muscle

Annotation:: Galt, galactose-1-phosphate uridyl transferase

Organism:: Mus musculus

Reporter:: GPL11533, 10504094 (ID_REF), GDS4918, NM_016658, BC010985, chr4:41702376-41705555 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 113744356

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10870259217.

Galt - Ubiquitin specific protease 22 depletion effect on embryonic stem cell line

Annotation:: Galt, galactose-1-phosphate uridyl transferase

Organism:: Mus musculus

Reporter:: GPL6246, 10504094 (ID_REF), GDS4973, NM_016658, AK163544, BC010985, M96265, AK088379, AK134525, chr4:41755503-41758682 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 108702592

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12234089218.

Galt - Death receptor knockout effect on NEMO-deficient model of chronic liver disease

Annotation:: Galt, galactose-1-phosphate uridyl transferase

Organism:: Mus musculus

Reporter:: GPL6246, 10504094 (ID_REF), GDS5332, NM_016658, AK163544, BC010985, M96265, AK088379, AK134525, chr4:41755503-41758682 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 11 samples

ID:: 122340892

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2852204419.

Galt - Guided differentiation into dopaminergic neurons and random differentiation into embryoid bodies

Annotation:: Galt, galactose-1-phosphate uridyl transferase

Organism:: Mus musculus

Reporter:: GPL2987, 9344 (ID_REF), GDS2227, BC010985

DataSet type:: Expression profiling by array, log ratio, 21 samples

ID:: 28522044

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8749999220.

Galt - Iroquois homeobox Irx3 and Irx5 deletion effect on embryonic heart

Annotation:: Galt, galactose-1-phosphate uridyl transferase

Organism:: Mus musculus

Reporter:: GPL6246, 10504094 (ID_REF), GDS4317, NM_016658, AK163544, BC010985, M96265, AK088379, AK134525, chr4:41755503-41758682 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 87499992

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 8

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 15012151) (160)
GEO Profiles
Levilactobacillus paucivorans strain DSM 22467 NODE_409, whole genome shotgun se...
Levilactobacillus paucivorans strain DSM 22467 NODE_409, whole genome shotgun sequence
gi|948985876|gb|JQCA01000165.1||gnl JQCA01|NODE_409

Nucleotide
Mus musculus strain C57BL/6J chromosome 3, GRCm39
Mus musculus strain C57BL/6J chromosome 3, GRCm39
gi|1877089966|gnl|ASM:GCF_000000055 f|NC_000069.7||gpp|GPC_000007815.1||gnl|NCBI_GENOMES|71

Nucleotide
Gpr160 G protein-coupled receptor 160 [Mus musculus]
Gpr160 G protein-coupled receptor 160 [Mus musculus]
Gene ID:71862

Gene
Gene Links for Nucleotide (Select 562155504) (1)
Gene

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 160

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity