GEO Profiles Links for Nucleotide (Select 27694048) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 145

<< First< Prev

Page of 8

Next >Last >>

Select item 74647761.

Snx14 - MPSS transcriptome analysis project

Annotation:: Snx14, sorting nexin 14

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGATAGTCAAGTGTAT (ID_REF), GDS868, BC043328

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7464776

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76024762.

Snx14 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Snx14, sorting nexin 14

Organism:: Mus musculus

Reporter:: GPL1010, GATCTGATAGTCAAGTGTAT (ID_REF), GDS878, BC043328

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7602476

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 841038383.

Snx14 - Chlamydia muridarum genital tract infection model: CD4 T cells

Annotation:: Snx14, sorting nexin 14

Organism:: Mus musculus

Reporter:: GPL6246, 10595573 (ID_REF), GDS4355, BC043328, NM_172926, AK082389, BC080799, chr9:88376752-88438936 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 84103838

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 968463384.

Snx14 - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Snx14, sorting nexin 14

Organism:: Mus musculus

Reporter:: GPL6246, 10595573 (ID_REF), GDS4486, BC043328, NM_172926, AK082389, BC080799, chr9:88376752-88438936 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96846338

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 793729385.

Snx14 - Diabetogenic 3A9 T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Snx14, sorting nexin 14

Organism:: Mus musculus

Reporter:: GPL6246, 10595573 (ID_REF), GDS4115, BC043328, NM_172926, AK082389, BC080799, chr9:88376752-88438936 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 79372938

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 881348386.

Snx14 - Sox9+ pancreatic cells: developmental time course

Annotation:: Snx14, sorting nexin 14

Organism:: Mus musculus

Reporter:: GPL6246, 10595573 (ID_REF), GDS4335, BC043328, NM_172926, AK082389, BC080799, chr9:88376752-88438936 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 88134838

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1144104387.

Snx14 - Transforming growth factor beta effect on cytokine-activated, NOD-derived, splenic natural killer cells

Annotation:: Snx14, sorting nexin 14

Organism:: Mus musculus

Reporter:: GPL6246, 10595573 (ID_REF), GDS4948, BC043328, NM_172926, AK082389, BC080799, chr9:88376752-88438936 (SPOT ID)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 114410438

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 794096388.

Snx14 - Diabetogenic BDC T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Snx14, sorting nexin 14

Organism:: Mus musculus

Reporter:: GPL6246, 10595573 (ID_REF), GDS4116, BC043328, NM_172926, AK082389, BC080799, chr9:88376752-88438936 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 79409638

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1143737389.

Snx14 - Regulatory T cell ablation effect on BDC2.5/NOD pancreatic or splenic natural killer cells: time course

Annotation:: Snx14, sorting nexin 14

Organism:: Mus musculus

Reporter:: GPL6246, 10595573 (ID_REF), GDS4946, BC043328, NM_172926, AK082389, BC080799, chr9:88376752-88438936 (SPOT ID)

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 114373738

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8809813810.

Snx14 - B7x effect on CD8 T cell-mediated diabetes model AI4αβ: pancreatic CD8 T cells

Annotation:: Snx14, sorting nexin 14

Organism:: Mus musculus

Reporter:: GPL6246, 10595573 (ID_REF), GDS4334, BC043328, NM_172926, AK082389, BC080799, chr9:88376752-88438936 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 88098138

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10644623811.

Snx14 - Histone deacetylase 3 deficiency effect on the heart

Annotation:: Snx14, sorting nexin 14

Organism:: Mus musculus

Reporter:: GPL6246, 10595573 (ID_REF), GDS4886, BC043328, NM_172926, AK082389, BC080799, chr9:88376752-88438936 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 106446238

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10526023812.

Snx14 - Methylmalonic acidemia-associated renal disease model: kidney

Annotation:: Snx14, sorting nexin 14

Organism:: Mus musculus

Reporter:: GPL6246, 10595573 (ID_REF), GDS4839, BC043328, NM_172926, AK082389, BC080799, chr9:88376752-88438936 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 105260238

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10007013813.

Snx14 - APCΔ468 model of polyposis: regulatory T cells from various organs

Annotation:: Snx14, sorting nexin 14

Organism:: Mus musculus

Reporter:: GPL6246, 10595573 (ID_REF), GDS4588, BC043328, NM_172926, AK082389, BC080799, chr9:88376752-88438936 (SPOT ID)

DataSet type:: Expression profiling by array, count, 44 samples

ID:: 100070138

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7556623814.

Snx14 - Regulatory, pathogenic and control CD4+ T cells

Annotation:: Snx14, sorting nexin 14

Organism:: Mus musculus

Reporter:: GPL6246, 10595573 (ID_REF), GDS3999, BC043328, NM_172926, AK082389, BC080799, chr9:88376752-88438936 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 75566238

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9968033815.

Snx14 - Lipopolysaccharide-stimulated, NFκB ζ inhibitor (IκBζ) deficient-peritoneal macrophages

Annotation:: Snx14, sorting nexin 14

Organism:: Mus musculus

Reporter:: GPL6246, 10595573 (ID_REF), GDS4578, BC043328, NM_172926, AK082389, BC080799, chr9:88376752-88438936 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 99680338

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8473293816.

Snx14 - DSS-induced colitis model response to enhanced siRNA targeting of Tumor necrosis factor α

Annotation:: Snx14, sorting nexin 14

Organism:: Mus musculus

Reporter:: GPL6246, 10595573 (ID_REF), GDS4371, BC043328, NM_172926, AK082389, BC080799, chr9:88376752-88438936 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 84732938

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7511543817.

Snx14 - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: Snx14, sorting nexin 14

Organism:: Mus musculus

Reporter:: GPL6246, 10595573 (ID_REF), GDS3987, BC043328, NM_172926, AK082389, BC080799, chr9:88376752-88438936 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75115438

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8751013818.

Snx14 - Iroquois homeobox Irx3 and Irx5 deletion effect on embryonic heart

Annotation:: Snx14, sorting nexin 14

Organism:: Mus musculus

Reporter:: GPL6246, 10595573 (ID_REF), GDS4317, BC043328, NM_172926, AK082389, BC080799, chr9:88376752-88438936 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 87510138

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9274373819.

Snx14 - Zinc finger transcription factor Fezf1 deficiency effect on main olfactory epithelial cells

Annotation:: Snx14, sorting nexin 14

Organism:: Mus musculus

Reporter:: GPL6246, 10595573 (ID_REF), GDS4446, BC043328, NM_172926, AK082389, BC080799, chr9:88376752-88438936 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 92743738

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9698373820.

Snx14 - Lmna G609G knock-in model of Hutchinson-Gilford Progeria Syndrome: liver

Annotation:: Snx14, sorting nexin 14

Organism:: Mus musculus

Reporter:: GPL6246, 10595573 (ID_REF), GDS4490, BC043328, NM_172926, AK082389, BC080799, chr9:88376752-88438936 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 96983738

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 8

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 27694048) (145)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 145

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity