GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Platform GPL21185

Query DataSets for GPL21185

Status

Public on Nov 30, 2015

Title

Agilent-072363 SurePrint G3 Human GE v3 8x60K Microarray 039494 [Probe Name Version]

Technology type

in situ oligonucleotide

Distribution

commercial

Organism

Homo sapiens

Manufacturer

Agilent Technologies

Manufacture protocol

see manufacturer's web site at http://www.agilent.com/

Description

Catalog gene expression microarray for Human, v3 8x60K

Arrays of this design have barcodes that begin with 16072363 or 2572363.

Submission date

Nov 30, 2015

Last update date

Feb 20, 2018

Organization

Agilent Technologies

E-mail(s)

cag_sales-na@agilent.com

Phone

877-424-4536

URL

http://www.agilent.com

Department

Street address

City

Palo Alto

State/province

ZIP/Postal code

94304

Country

USA

Samples (5184)

More...

GSM1966830, GSM1966831, GSM1966832, GSM1966833, GSM1966834, GSM1966835

Series (409)

More...

GSE66244	Identification of expresion patterns after treatment with GC/RA and combination with AZA/SAHA in MYC amplified and BRG1 mutant lung cancer cell lines
GSE66245	Treatment with GC/RA and combination with AZA/SAHA in MYC amplified and BRG1 mutant lung cancer cell lines
GSE75755	siRNA knockdown of GALNT2 in gastric adenocarcinoma AGS cells

GSE76581	siRNA knockdown of GATA3 or HIF-1α in OEC-M1 cells under hypoxia
GSE81369	The funtion of DCLK1 in PNET cell
GSE81373	Small extracellular vesicles secreted from senescent cells promote cancer cell proliferation through EphA2.
GSE81727	Cordycepin induces apoptosis by caveolin-1 mediated JNK’s regulation of Foxo3a in lung cancer A549 cells
GSE81728	Cordyceps promotes MKK7-JNK signaling pathway by reducing NF-κB/GADD45b signaling activation to induce apoptosis in TK-10 renal cell carcinoma
GSE82050	IFI27 is a gene-expression biomarker that identifies influenza-specific immune response in symptomatic patients
GSE83628	Gene expression changes with knock-down of linc-9432
GSE83643	Gene expression profiles of U87 cells after transfection with hsa-miR-145-5p and 31-5p
GSE84007	Knock down of MTHFD2 of lung adenocarcinoma cell line H322
GSE85348	Vulnerability of Purkinje cells induced from spinocerebellar ataxia type 6 patient-derived iPS cells [2]
GSE85349	Vulnerability of Purkinje cells induced from spinocerebellar ataxia type 6 patient-derived iPS cells
GSE86183	mRNA expression profiling after Ago2-immunoprecipitation (IP) in unstimulated and TGF-β1-stimulated primary parenchymal lung fibroblasts of two control subjects
GSE86186	miRNA expression data before and after TGF-β treatment and Ago2-associated transcripts in lung fibroblasts
GSE86437	Human Gastric Cancer Cell line MKN45: Non-Target shRNA vs. SET/I2PP2A targeting shRNA
GSE87753	Gene expression analysis of LinSLiT08211 KO cells against Salmonella infection
GSE87754	Gene expression analysis of enSLiT KO cells against Salmonella infection
GSE88768	Identification of PPARG regulated genes in human GM-CSF-primed monocyte-derived macrophages
GSE89328	Comparison of the activated lymphocyte into which shPTPN3 was introduced and the activated lymphocyte into which a control vector was introduced
GSE90616	CTCL cell line H9:vehicle control vs.ShBCL11B
GSE93768	Tumor suppression via inhibition of SWI/SNF complex-dependent NF-kappaB activation [A549 subset]
GSE93769	Tumor suppression via inhibition of SWI/SNF complex-dependent NF-kappaB activation [HeLaS3 subset]
GSE93770	Tumor suppression via inhibition of SWI/SNF complex-dependent NF-kappaB activation
GSE93860	Gene Expression Profile Changes due to Bleomycin-Induced DNA Damage in Human Fibroblasts in Space
GSE94441	Analysis of gene expression in human LHCN-M2 cells with siControl or siZNF 148
GSE95324	expression changes by establishing metastasis
GSE96036	Gene expression during chondrocyte differentiation from human iPS cells by the 2C method
GSE96720	Genome-wide analysis of the toxic effect of hydroxyl-modified Graphene quantum dots (GQD) on normal human esophageal epithelial cells
GSE97318	Restoring PU.1 induces apoptosis and modulates viral transactivation via interferon-stimulated genes in primary effusion lymphoma
GSE97387	Whole-genome gene expression profiling of UGT2B15 Knockdown/Negative Control MHCC-97H Cell Line
GSE97414	Gene profiling of HAX1-deficient iPSC-derived CD33-positive promyelocytes and their genetically corrected and wid-type counterparts
GSE97542	Gene expression profile of MDL-860-treated RD cells
GSE97572	The effect of SPARCL1 overexpression on osteosarcoma MNNG-HOS cell line
GSE97931	Expression data comparing BEL7402 HCC cells with or without PRMT6 stably repressed.
GSE98026	Downstream genes and pathways of ASH1-miR-375-YWHAZ axis in hepatocellular carcinoma
GSE98560	Transcriptome analysis in endometrioid cell lines with modified Prex2a expression
GSE99007	The difference of placental fibroblast between normal pregnancy and preeclampsia
GSE99158	Niche microenvironments are essential for maintaining the phenotypic heterogeneity of primary cancer
GSE99995	Whole-transcriptome analysis of tumor tissues of lung adenocarcinoma reveals molecular changes under the influence of IFN-γ
GSE100658	miR-204 blocks MYCN expression and is a novel a tumor suppressor in neuroblastoma tumorigenesis
GSE100902	Wound healing related cells: Control vs. SE-14000 stimulation
GSE101702	Host response to IAV infections in human patients
GSE102208	Duodenal adenoma/adenocarcinomas vs matched normal mucosa
GSE102536	Gene expression profiling after a chronic exposure to benzo[a]pyrene (B[a]P) and/or ethanol in steatotic or non-steatotic HepaRG cells.
GSE102896	Effects of blackcurrant extract on gene expression on TIG113.
GSE102985	Gene expression profile of erythroblastic cells induced from congenital dyserythropoietic anemia (CDA) patient-derived induced pluripotent stem cells
GSE104468	The Nasal Methylome: A Key to Understanding Allergic Asthma [Agilent]
GSE104472	The Nasal Methylome: A Key to Understanding Allergic Asthma
GSE104806	Wild-type P53 proteolytic inactivation by asparagine endopeptidase promotes glioblastoma progression
GSE104958	A 17-molecule set as a predictor of complete response to neoadjuvant chemotherapy with docetaxel, cisplatin, and 5-fluorouracil in esophageal cancer
GSE105033	A heterochromatin gene signature unveils HP1α mediating neuroendocrine prostate cancer development and aggressiveness
GSE106603	Gene expression data of PFKFB3 KD in SMMC7721 cell line
GSE106783	Gene expression profile of TRA-1-60 population in FL cell line
GSE108560	Gene expression profile of FMR1-KO iPSCs-derived NPCs
GSE108722	Gene Expression of Bone Marrow Endothelial Cells under Radiated and Radioprotective Conditions
GSE108723	HUVEC Gene Expression of Irradiated Human Umbilical Vein Endothelial Cells
GSE109497	THOC2 RNAi microarray in A375 cell line
GSE109585	The antifibrotic activity of the selective IP receptor agonist ACT-333679 is mediated through inhibition of YAP/TAZ signaling
GSE110140	RUNX2 promotes the development of Blastic plasmacytoid dendritic cell neoplasm (BPDCN)
GSE110237	Gene expression changes in gastric and colon cancer cell lines after RHOA knockdown.
GSE110777	DNA Methylation Changes in Lung Immune Cells are Associated with Granulomatous Lung Disease [sarcexp]
GSE110780	DNA Methylation Changes in Lung Immune Cells are Associated with Granulomatous Lung Disease
GSE110822	Integrative analysis of DNA methylation and gene expression data among preterm and/or small for gestational age infants during perinatal period [expression]
GSE110829	Integrative analysis of DNA methylation and gene expression data among preterm and/or small for gestational age infants during perinatal period
GSE111106	Rostrocaudal Areal Patterning of Human PSC-Derived Cortical Neurons by FGF8 Signaling
GSE111422	Multiple myeloma cell lines expression profile of OTX015-treated cells compared to DMSO controls
GSE111914	Hypoxia and ERα Transcriptional Crosstalk Is Associated with Endocrine Resistance in Breast Cancer
GSE111989	Generation of splice switching oligonucleotides targeting the Cockayne syndrome group B gene product in order to change the diseased cell state
GSE112029	ZNF281 inhibits neuronal differentiation
GSE112144	Effects of glucose on gene expression of human dental pulp cells under odontogenic differentiation
GSE112630	Gene expression profiling of human cardiac macrophages sorted from failing human hearts
GSE113028	LGP2 virus sensor regulates gene expression network mediated by TRBP-bound microRNAs.
GSE113033	Gene expression profiling of novel hematopoietic stem cell subpopulations defined by CD35 expression and progenitor populations in human adult hematopoiesis
GSE113860	Gene expression analysis of parental and sulfasalazine-resistant human oral squamous carcinoma cell line OSC19
GSE114942	Carbonic anhydrase 13 decreases bone metastasis of iCSCL-10A breast cancer stem cells
GSE115854	Screening of the target genes of 3miRNAs: has-miR-296-5p, has-miR-324-3p and has-miR-3928-3p.
GSE116023	Mefloquine disrupts cancer stem cells by inhibiting lysosomal RAB5/7 mediated mitophagy
GSE116167	The transcriptome profile of the stomach fibroblasts with high-metastatic or low-metastatic gastric cancer cell.
GSE116176	The transcriptome profile of the stomach fibroblasts with high-metastatic or low-metastatic gastric cancer cell-derived extracellular vesicles.
GSE116211	Differentially expressed genes following ARID1A depletion
GSE116418	siRNA knockdown of C1GALT1 in SAS cells
GSE116849	ARPCs Can Revert Lps-Induced Endothelial-to-Mesenchymal Transition of Endothelial Cells
GSE117360	Effects of blackcurrant extract on gene expression on human follicle dermal papilla cells.
GSE117491	Effect of cold atmospheric plasma (CAP) on MCF-7 breast cancer cell (Agilent Human GE v3 8x60K Microarray)
GSE117683	ChIP-seq analysis reveals alteration of H3K4 trimethylation occupancy in cancer-related genes by cold atmospheric plasma
GSE117858	Genome-wide comparison of differentially expressed genes in hepatoma cell lines with and without treatment of dimethyl dicarboxylate biphenyl
GSE118243	Early regulatory B cell induction and Th/Tr17 responses relates to success of long-term grass-pollen AIT
GSE118273	Gene expression prfile of ARID1A knockout N87 cells
GSE119651	Gene expression analysis of BeWo cells stimulated by tumor necrosis factor-alpha and insulin-like growth factor-I
GSE119924	Gene expression analysis after shRNA-mediated knockdown of Myc-induced lncRNA KTN1-AS1 in ST486 Burkitt lymphoma cells
GSE119925	shRNA-mediated Myc knockdown and shRNA-mediated knockdown of Myc-induced lncRNA KTN1-AS1 in ST486 Burkitt lymphoma cells
GSE120194	Identification and integrative analysis of microRNAs and mRNAs involved in proliferation and invasion in mechanical pressure-treated human hepatocellular carcinoma cell lines (mRNA)
GSE120325	Compound-induced NR5A1 exon-skipping and circular-RNA expression show impaired steroidogenesis in adrenocortical cancer cells
GSE120785	Gene expression from fibroblast-like synoviocytes (FLS) of three patients with rheumatoid arthritis (RA) that were cultured in four conditions: control medium (Basal), ATRA, TNF and ATRA+TNF.
GSE121618	Expression Profile of Isolated Endothelial cells in Human Keloids: A microarray analysis
GSE121730	Effects of blackcurrant extract on gene expression on Human Umbilical Vein Endothelial Cells.
GSE121787	Tumor region-specific microarray analysis according to trastuzumab distribution in breast cancer patient derived xenograft
GSE121825	Identification of the genes regulated by the 5-HT2B serotonin receptor agonist BW723C86 in human M-CSF-primed monocyte-derived macrophages
GSE122023	Comprehensive and comparative analysis of gene expression induced by LPA- and CP-609,550 in normal human epidermal keratinocytes (NHEKs)
GSE122046	Endothelium muscle-specificity induction and fibroblast recruitment in engineered 3D human muscle environment for the study of fibrosis
GSE122146	gene expression when silencing RBMS3 in ovarain cancer cell line SKOV3
GSE122522	Therapeutic targeting of BRD4 in head neck squamous cell carcinoma
GSE122671	Gene expression of peripheral blood leukocytes in athletes
GSE122997	Analysis of whole genome expression change after NPD13668 treatment
GSE123465	mRNA expression profiles for ectoderm-biased substate of human pluripotent stem cells.
GSE123530	Evaluation of gene expression between ALDH-high and ALDH-low cells in endometrial cancer-derived spheroids
GSE124272	Transcriptome signatures reveal candidate key genes in the whole blood of patients with lumbar disc prolapse
GSE124502	The mRNA profile of human bronchial epithelial cells transfected with miR-23b-3p, miR-145-5p and miR-494-3p
GSE124832	Transcriptomic features of trophoblast lineage cells derived from BMP4-treated human induced pluripotent stem cells
GSE124917	Human renal fibroblasts are strong immunomobilizers during a urinary tract infection mediated by uropathogenic Escherichia coli
GSE125543	Inhibition of gene transcription after THZ1 treatment in HeLa
GSE125824	Assessment of gene expression signatures for overexpression of miR-1285-5p in breast cancer
GSE127181	Gene expression analysis of human CD34+ AML cells cultured with or without gabapentin
GSE127773	Molecular signature of asthma-enhanced sensitivity to aerosols of pristine and carboxylated CuO nanoparticles, identified in 3D cell models.
GSE128146	Gene expression analysis of human CD34+ ALL cells cultured with or without gabapentin
GSE128222	Tumor regression of recurrent chemo-resistant placental site trophoblastic tumor after anti-PD-1 immune checkpoint inhibitor therapy
GSE128617	Late recurrence-associated long non-coding RNA NR2F1 antisense 1 (NR2F1-AS1) II
GSE128726	Energy metabolism and cell motility defect in NK-cells from patients with Hepatocellular Carcinoma
GSE129429	Critical roles of translation initiation and RNA uridylation in endogenous retroviral expression and neural differentiation in pluripotent stem cells
GSE129615	The MicroRNAs target mitochondrial dynamics and metabolism to regulate mitochondrial-mediated antiviral innate immunity
GSE129875	Elucidating miRNA associated with cisplatin resistance in head and neck cancer cells
GSE130144	PHD inhibition upregulates glycolytic pathway in OGD
GSE130761	PIPKIγ promotes tumor growth by facilitating Warburg effect in colorectal cancer
GSE131081	The comparison of RNA expression between primary and CR cells
GSE131477	Effect of cold atmospheric plasma (CAP) in MCF-7 breast cancer cells [dataset 1]
GSE131478	Effect of cold atmospheric plasma (CAP) in MCF-7/TxR breast cancer cell [dataset 2]
GSE131479	Effect of cold atmospheric plasma (CAP) in MCF-7 breast cancer cell [dataset 3]
GSE131480	Effect of cold atmospheric plasma (CAP) in MCF-7
GSE131648	Erythroblasts from human cord blood
GSE131813	Gene expression analysis of THP-1 cells cultured with or without BCAA
GSE131814	Gene expression analysis of Kasumi9 cells cultured with or without BCAA
GSE131815	Gene expression analysis of Jurkat cells cultured with or without BCAA
GSE131888	Gene expression alteration regulated by BCAA-metabolism in human acute leukemia
GSE132161	miR-26a regulate the extracellular vesicle secretion from prostate cancer cells via targeting PFDN4, CHORDC1 and SHC4
GSE132328	Chemotherapy response in cholangiocarcinoma
GSE132614	ELOVL2 is a novel tumor suppressor attenuating tamoxifen resistance in breast cancer via suppressing the AKT pathway [gene expression]
GSE132617	ELOVL2 is a novel tumor suppressor attenuating tamoxifen resistance in breast cancer via suppressing the AKT pathway
GSE133776	Reprogramming of primary human hepatocytes (PHHs) into hCLiPs
GSE133777	Hepatic induction of hCLiPs
GSE133778	Characterization of long term-cultured of hCLiPs
GSE133779	Transcriptomic analysis of PHHs isolated from hCLiP-transplanted mouse chimeric liver
GSE133797	human hepatocytes (PHHs) and human chemcically induced progenitors (hCLiPs) study
GSE133835	Identification of IVIg regulated genes in human peripheral blood mononuclear cells from Common Variable Immunodeficiency patients (CVID) [PMBC]
GSE133907	Identification of IVIg regulated genes in human peripheral blood monocytes from Common Variable Immunodeficiency patients (CVID) [CD14+]
GSE134386	Molecular Fingerprints of Borderline Changes of Kidney Allografts is Influenced by Donor Category
GSE134672	Comparison between infant and adult primary human hepatocytes (PHHs) in terms of their responsiveness to FAC (FBS + A83-01 + CHIR99021)
GSE134921	Gene Expression Profiles Associated with A Simple and Reliable Myeloid Signature for HCC
GSE135150	Validation of human microRNA target pathways enables evaluation of target prediction tools [mRNA]
GSE135151	Validation of human microRNA target pathways enables evaluation of target prediction tools
GSE135547	LGP2 virus sensor enhances apoptosis by upregulating apoptosis-regulatory genes through TRBP-bound miRNAs during viral infection
GSE135977	CPP stimulation
GSE136120	Exploring the molecular mechanism and and related signaling pathways of annexin A2 in human retinal vascular endothelial cells
GSE136696	Development of gene expression signatures for lncRNA MRPL23-AS1 down regulation
GSE136697	Development of gene expression signatures for lncRNA MRPL23-AS1 up-regulation
GSE136698	Development of gene expression signatures for lncRNA MRPL23-AS1
GSE137578	Novel mirnas participate in Atherosclerosis through inflammation and apoptosis pathways (HAEC mRNA)
GSE137996	Conjunctival mRNA and miRNA expression profiles in congenital aniridia are genotype and phenotype dependent (AKK mRNA)
GSE137997	Conjunctival mRNA and miRNA expression profiles in congenital aniridia are genotype and phenotype dependent
GSE138282	Expression analysis after EZH1,2 inhibition in lymohoma cells
GSE139511	Tuberculosis-associated IFN-I induces Siglec-1 on microtubule-containing tunneling nanotubes and favors HIV-1 spread in macrophages
GSE141642	Gene expression in PC3 cells(human prostate cancer cell line) upon HIC1 knockout
GSE141691	MiR-378a-3p is critical for Burkitt lymphoma cell growth
GSE142287	Prostate cancer organotypic slice cultures (OSC) treated with E2 or DHT
GSE142552	Interleukin-17A suppresses granular layer formation in a three-dimensional human epidermis model via regulation of terminal differentiation genes
GSE143198	SMARCA4 reads PRMT1-mediated H4R3me2a to promote colorectal cancer progression I
GSE143199	SMARCA4 reads PRMT1-mediated H4R3me2a to promote colorectal cancer progression II
GSE143350	Spermidine synthase regulates extracellular vesicle secretion in castration resistant prostate cancer.
GSE144457	MAX-mutant small cell lung cancers sustain impaired activities of the MGA-dependent ncPRC1
GSE144715	Comparative Transcriptomic Analysis of Vascular Endothelial Cells after Hypoxia/Reoxygenation Induction
GSE145374	Myeloid-derived suppressor cells promote epithelial ovarian cancer cell stemness by inducing the CSF2/p-STAT3 signalling pathway
GSE145624	Combined pitavastatin and capmatinib inhibits tumor growth though completed shutdown of MET signal
GSE147162	Transcriptional profiles of inguinal fat of HIV-infected and healthy control patients.
GSE147566	Metabolic re-programming by MALAT1 depletion in prostate cancer
GSE147610	The effect of exosomes on ovarian cancer cells with regard to gene expression
GSE148983	GRB10 sustains AR activity by interacting with PP2A in prostate cancer cells
GSE149321	Genomic and physiological resilience in extreme environments are associated with a secure attachment style
GSE150044	Hippo pathway induces PIEZO1 expression to promote oral squamous cell carcinoma cell proliferation
GSE150348	Gene expression signatures of A2058 cells treated with neopetasin, metformin, and phenformin
GSE150408	Identification of key genes potentially related to intervertebral disc degeneration by microarray analysis
GSE150655	Modification of gene expression in prostate cancer cells treated with Perfluorooctanoic acid
GSE151040	DNA damage-induced genes in KMS12PE cells
GSE151191	Gene expression of breast cancer stem cells.
GSE151560	Profiling the response of scalp hair follicles to short-term treatment with hepatocyte growth factor
GSE151972	Characterizing gene expression changes within the human hair follicle bulb driven by hepatocyte growth factor secreted by perifollicular fat
GSE153051	PD-L1 lncRNA splice promotes lung adenocarcinoma proliferation and metastasis via enhancing c-Myc activity
GSE153199	Gene expression changes induced by ILB in Schwann like cells
GSE153318	Metformin on human macrophages
GSE153326	Host transcriptional response to TB preventive therapy differentiates two sub-groups of IGRA-positive individuals: PAXgene ex vivo samples
GSE153340	Host transcriptional response to TB preventive therapy differentiates two sub-groups of IGRA-positive individuals: in vitro (Quantiferon tube)-stimulated blood
GSE153342	Host transcriptional response to TB preventive therapy differentiates two sub-groups of IGRA-positive individuals
GSE153460	Suppression of lysosomal acid alpha-glucosidase impacts the modulation of transcription factor EB translocation and mitophagy in pancreatic cancer
GSE154584	Gene expression in gamma-glutamylcyclotransferase-depleted human prostate cancer PC3 cells.
GSE154723	Gene expression plofile in human articular cartilage-derived cells cultured by different culture methods
GSE155157	Small cell neuroendocrine transdifferentiation in EGFR-mutant lung cancer evolving from mesenchymal drug-tolerant state
GSE155389	Adoptive cell therapy using cultured tumor infiltrating lymphocytes for Japanese patients with refractory melanoma
GSE155591	Gene expression of KYSE410 cells with treatment of 10 uM FAK inhibitor (defactinib) for 4 hours and 24 hours
GSE155754	Identification of differentially expressed genes influenced by NCOA6 in 22Rv1 human prostate cancer cells
GSE155757	NCOA6 is a potent prostate cancer suppressor essential for NFY-mediated restriction of EGFR overexpression
GSE156344	A lncRNA HAR1B has a potential as a predictive marker for pazopanib therapy in patients with sarcoma
GSE156355	Gene expression data for tumor and paired adjacent normal tissues from colorectal cancer patients
GSE156834	The role of ESRG in human pluripotency
GSE158573	Identification of IVIg regulated genes in human peripheral blood monocytes by gene expression analysis before and after IVIg infusion in CVID patients [CD3]
GSE158576	Identification of IVIg regulated genes in human peripheral blood B cells by gene expression analysis before and after IVIg infusion in CVID patients [CD20]
GSE159088	Liver gene expression profile in human NAFLD (men and women)
GSE159093	Improving the efficacy of EGFR inhibitors by topical treatment of cutaneous squamous cell carcinoma with miR-634 ointment
GSE159572	Analysis of gene expression signatures for RAB27A knockdown
GSE159573	Analysis of gene expression signatures for Met knockdown by siRNA
GSE159605	A novel patient stratification strategy to enhance the therapeutic efficacy of dasatinib in glioblastoma [Agilent]
GSE159609	A novel patient stratification strategy to enhance the therapeutic efficacy of dasatinib in glioblastoma
GSE159661	Gene expression signatures for breast cancer cell lines
GSE159823	Ubiquitin-specific peptidase 39 promotes human glioma cells migration and invasion by facilitating ADAM9 mRNA maturation
GSE160276	B-cell transcription factor PAX5 functions as a tumor suppressor by regulating the cell cycle in primary effusion lymphoma
GSE160395	Transcriptomic profiling between HSC-3 cells and its highly metastatic subline, HSC-3-M3 cells
GSE161364	Impact of PRRX1 knockdown on the transcriptome of normal human lung fibroblasts (NHLF) in the presence or the absence of TGF-β
GSE161488	Ovarian cancer cell line (OVCAR-3): control vs. defined factors (OCT3/4, SOX2, KLF4, c-MYC) transfected
GSE162102	Gene expression of autopsy samples from small cell lung cancer patients
GSE162286	Transcriptional profiling of human malignant mesethelioma cells that have constitutively treated with sialic acid binding lectin from Rana catesbeiana (cSBL)
GSE163002	SLUG is enhanced by chemotherapeutics and functions to promote invasion and metastasis by directly targeting MMP3 in Cervical Cancer
GSE163355	gene expression of KYSE510 cells with treatment of 100 nM PAF for 24 hours
GSE164168	Lack of TRMT2A, a tRNA methyltransferase, induces the generation of tRNA-derived small RNAs due to m5U54 tRNA hypomodification [Array]
GSE164201	The effect of CDDP and iron chelators for squamous cell carcinoma
GSE164327	Sphere-derived multipotent progenitor cells obtained from human oral tissue neural crest-derived cells
GSE164406	Lack of TRMT2A, a tRNA methyltransferase, induces the generation of tRNA-derived small RNAs due to m5U54 tRNA hypomodification
GSE165029	A Novel Molecular Target in Epidermal Growth Factor Receptor-Mutant Non-Small Cell Lung Cancer treated with a Combination of Osimertinib and Pemetrexed
GSE165451	Identification of gene related to stem cells from human exfoliated deciduous teeth (SHED) into epithelial-like differentiation using co-culture in epithelial microenvironment
GSE166199	The effects of SNAI2 overexpression on the transcriptional program in HaCaT cells
GSE166200	The effects of TGF-β1-induced EMT on the transcriptional program in HaCaT cells
GSE168048	Prognosis associated mRNA in peripheral blood mononuclear cells (PBMCs) from hepatitis B virus-related acute-on-chronic liver failure (HBV-ACLF) [mRNA]
GSE168049	Prognosis associated mRNA and microRNA in peripheral blood mononuclear cells (PBMCs) from hepatitis B virus-related acute-on-chronic liver failure (HBV-ACLF)
GSE168280	MUSASHI-2 RNA binding protein confers resistance to an epidermal growth factor receptor-tyrosine kinase inhibitor Osimertinib in lung adenocarcinoma
GSE168845	Gene expression profile of cancerous and non-cancerous renal tissues
GSE168903	Identification of genes regulated by MYCN in retinoblastoma (RB) cell line, Y79.
GSE168904	Gene expression based profiling of pleomorphic xanthoastrocytoma highlights two prognostic subgroups
GSE168912	Gene expression profiles of LMNA-V6 silencing or overexpression in HCT116 cells
GSE171627	The role of ESRG in human pluripotency III
GSE171667	The effect of DMD on THP1 macrophages in response to IMQ.
GSE171880	Impact of miR-143-3p and miR-145-5p overexpression on human M238P melanoma cells
GSE171883	Blockade of the pro-fibrotic reaction mediated by the miR-143/-145 cluster enhances the responses to targeted therapy in melanoma
GSE172120	Differentially expressed genes in HNSCC tissues, normal oral epithelial tissues and CAFs
GSE172168	ERAP2 is a novel target involved in autophagy and activation of pancreatic stellate cells via unfolded protein response signaling pathway
GSE172419	Differential angiogenesis of bone and muscle endothelium in aging and inflammatory processes
GSE173969	Gene Expression of Serous Cystic Neoplasm of the Pancreas Tissues
GSE174517	Transcriptional changes in HK-2 cells treated with lysophosphatidylcholine (LPC)
GSE174595	Identification of Differentially Expressed Genes in Human Gingival and Periodontal Derived Stromal Cells Compared with Human Dermal Fibroblasts
GSE175601	Identification of differentially expressed genes using microarray analysis and COL6A1 induction of bone metastasis in non-small cell lung cancer
GSE176086	Gene expression of human bone marrow mesenchymal stem cell (hBMSCs) during osteogenesis with or without TNF-alpha
GSE176467	Gene expression in human breast cancer T47D cells associated with expression of PTH-AS, a lncRNA downstream of parathyroid hormone
GSE178115	Synergistic chemical combination for cell cycle restoration in senescent cells via FoxM1 and E2F1 activation
GSE178434	Human corneal endothelial cells, iPS cells, CECSi cells, and neural crest cells
GSE178460	Integrative transcriptomics reveals activation of innate immune responses and inhibition of inflammation during oral immunotherapy for egg allergy in children
GSE179187	Wound healing and anti-oxidant activities induced by Dersani Hydrogel with Alginate and Dersani Hydrogel ointments
GSE180077	Differentially expressed genes in HSCC tissues, Normal hypopharyngeal tissue and Cervical lymph nodes
GSE180606	Network-based assessment of HDAC6 activity is highly predictive of pre-clinical and clinical responses to the HDAC6 inhibitor ricolinostat [array]
GSE180607	Network-based assessment of HDAC6 activity is highly predictive of pre-clinical and clinical responses to the HDAC6 inhibitor ricolinostat
GSE181593	Subtypes in human pancreatic ductal adenocarcinoma based on niche factor dependency show distinct drug treatment responses
GSE182357	miR-155 inhibits DEPTOR in gastric diffuse large B-cell lymphoma resistant to H. pylori eradication therapy
GSE182362	miR-155-regulated mTOR and Toll-like receptor 5 in gastric diffuse large B-cell lymphoma
GSE182503	Transcriptomic profiling of adult-onset asthma related to damp and moldy buildings and idiopathic environmental intolerance [blood]
GSE182797	Transcriptomic profiling of adult-onset asthma related to damp and moldy buildings and idiopathic environmental intolerance [nasal biopsy]
GSE182798	Transcriptomic profiling of adult-onset asthma related to damp and moldy buildings and idiopathic environmental intolerance
GSE183349	Gene expression profiling of Tumor and liver infiltrating NK cells from patients with Hepatocellular Carcinoma
GSE183473	Microarray analysis of OVSAHO and KURAMOCHI cells incubated with simvasatin or L-778123
GSE183509	Study on anti-HBV mechanism of Liuweiwuling Tablet (LWWL) based on transcriptomics
GSE183524	TGF-β orchestrates proliferation and migration of cancer cells via KRTAP2-3
GSE183648	Loss of p53 suppresses replication stress-induced DNA damage in ATRX-deficient neuroblastoma
GSE183786	Effect of NAM on the TGFβ1-induced hESC-derived corneal endothelial progenitor cells
GSE183926	Differentially expressed genes after transfection of siRNA in human cancer cell lines
GSE184182	Local and systemic multiomics signature of eosinophilic esophagitis (EO) in children
GSE184382	Sputum microRNA‐screening reveals Prostaglandin EP3 receptor as selective target in allergen‐specific immunotherapy
GSE185312	PSAT1 drives extracellular vesicle release in multiple types of cancer and promotes bone metastasis by activating osteoclasts
GSE185576	Human patients with influenza virus and bacterial infections
GSE185878	Gastric adenocarcinoma of fundic gland type vs matched normal mucosa
GSE186286	High sodium reduced the expression of PTH1R and Klotho by inhibiting 1,25 (OH)2D3 synthesis in cultured proximal tubule epithelial cells
GSE188310	Gene expression analysis to identify target genes of miR-150 in Hodgkin lymphoma cell lines
GSE188374	Transcriptome analysis for knee cartilage tissues of adults and cultured finger chondrocytes of children
GSE188531	Sex-biased and random monoallelic expression of SHOX: implications for sex difference in height
GSE188630	Study of ebola virus VP35 protein on gene expression in HepG2 cells
GSE188881	Gene expression data of SPC25 KD in HCCLM3 cell line
GSE189290	Differentially expressed genes in head and neck cancer cell line (Sa3), control Sa3 and miR-30e-3p transfected Sa3
GSE192653	Hepatocytes :MH vs. ProliHH vs. PHH vs. HLC
GSE192850	Whole genome expression profile of human decidual PMN-MDSC and autologous neutrophils in normal pregnancy
GSE193185	Comparison of cyclic compressive stimulation and proinflammatory cytokine stimulation of three-dimensional cultured human articular chondrocytes
GSE193629	The role of lnc-TMPRSS15 when human lens epithelial cells exposed to dexamethosone
GSE193843	Change of gene expression for elemene in RBE
GSE193875	CAF from metastatic ovarian cancer (mCAF) vs CAF from non-metastatic ovarian cancer (nmCAF)
GSE193957	Microarray analysis of glioma cell lines : Temozolomide Sensitive vs. Resistant
GSE194248	Human prostate cancer cells (VCaP and AIVCaP): siAR alone (single siRNA) vs. siAR plus OPRK1 (combo-siRNA)
GSE194269	Therapeutic potential for reversing miR-634-mediated cytoprotective processes to improve the efficacy of chemotherapy against oral squamous cell carcinoma
GSE194296	gene expression of Fibroblasts after hypoxia
GSE195896	Gene expression analysis of U87 cells with nuclear and non nuclear IGF1R localization
GSE197905	Analysis of estrogen-induced mRNA in endometrial cancer cells with forced expression of ER
GSE198692	Transcriptome of sessile serrated adenoma/polyps shows a relation with MSI-high colorectal cancer and decrease of CDX2
GSE199050	Analysis of gene expression profile in photoreceptor-like cells derived from fibroblasts
GSE199655	Comprehensive analysis for gene expressions of normal human dermal fibroblasts supplemented with N-acetylglucosamine -bearing polymers
GSE199656	O-GlcNAc-modified proteins leaked from dead cells suppress fibrosis
GSE199841	Gene expression signatures in patients with posttraumatic stress disorder (PTSD) and healthy controls
GSE200823	Gene expression profiles during the process of differentiation of HL-60 cells into neutrophils [HL60]
GSE200824	Gene expression profiles during the process of differentiation of HL-60 AK2 hetero-knockout clone #5 cells into neutrophils [HL60AK2KO_clone5]
GSE200825	Gene expression profiles during the process of differentiation of HL-60 AK2 hetero-knockout clone #47 cells into neutrophils [HL60AK2KO_clone47]
GSE200826	Gene expression profiles during the process of differentiation of HL-60 clone 15 cells into eosinophils [HL60cl15]
GSE200827	Gene expression profiles during the process of differentiation of HL-60 cells into neutrophils or eosinophils
GSE201260	Expression profile of mRNAs regulated by KNTC1 in HeLa cell
GSE201440	Investigating the transcriptomics of MCL-1 knockout Nasopharyngeal carcinoma cell lines using next generation microarray technology
GSE201469	Microarray profiling of mRNA in Chlamydia trachomatis-infected recurrent spontaneous aborters
GSE201608	Gene expression data in the human non-small cell lung cancer cell line NCI-H1975 and osimertinib-resistant OR1 and OR2 cells
GSE202030	A novel CREB5/TOP1MT axis confers cisplatin resistance through inhibiting mitochondrial apoptosis in head and neck squamous cell carcinoma
GSE202316	MicroRNA-449a inhibits triple negative breast cancer by disturbing DNA repair and chromatid separation
GSE202615	Gene expression of Tfh cells in the lessions of IgG4-related disease.
GSE202616	Gene expression of CD4+CD8+ Tfh cells and CD4+CD8- Tfh in tonsil.
GSE202617	Gene expression of CD4+CD8+ Tfh cells in lesions of IgG4-related disease and CD4+CD8+ Tfh in tonsil.
GSE203025	A novel histone deacetylases inhibitor exerts promising anti-breast cancer activity via triggering AIFM1-dependent programmed necrosis
GSE204775	NSD1 mutations in Sotos Syndrome induce differential expression of long non-coding RNAs, miR646 and genes controlling the G2/M checkpoint
GSE204791	Altered regulation of mRNA and miRNA expression in epithelial and stromal tissue of keratoconus corneas [RNA]
GSE204839	Altered regulation of mRNA and miRNA expression in epithelial and stromal tissue of keratoconus corneas
GSE205120	mRNA microarray related to circRNA in human umbilical vein endothelial cells
GSE205185	Microarray gene expression profile of primary breast tumour tissue
GSE205264	miRNA and mRNA array related to circRNA in human umbilical vein endothelial cells
GSE205543	Gene expression profiling of hepatocyte-like cells from human mesenchymal stem cells
GSE205751	Increased expression of LOC100506314 in T cells from patients with vitiligo and contributed to the pathogenesis of vitiligo
GSE206473	SOX11 promotes skin fibrosis by inducing fibrotic factors
GSE206715	Multi-omic signatures of Chronic Beryllium Disease bronchoalveolar lavage cells relate to T cell function and innate immunity [Expression]
GSE206719	Multi-omic signatures of Chronic Beryllium Disease bronchoalveolar lavage cells relate to T cell function and innate immunity
GSE206912	Identification of a minimum number of genes to predict triple negative breast cancer subgroups from gene expression profiles
GSE207432	Distinct leukemogenic mechanism of acute promyelocytic leukemia based on genomic structure of PML-RARα fusion gene
GSE207744	Transcriptomic study on human skin samples: identification of actinic keratoses two risk classes.
GSE208099	Gene expression analysis of M and SM gastric cancer
GSE208164	Colonic TRPV4 overexpression is related to constipation severity
GSE209727	Unique expression profile for type-I, -II, and -III IFNs regarding epithelial reorganization in primary epithelial cells
GSE209874	MicroRNA and mRNA expression profiles of hepatobiliary tumor patients' tissue together with those of non-tumor part tissues and serum exosomes. (mRNA)
GSE209875	MicroRNA and mRNA expression profiles of hepatobiliary tumor patients' tissue together with those of non-tumor part tissues and serum exosomes.
GSE209929	Comprehensive gene expression of fibroblasts from idiopathic pulmonary fibrosis patients
GSE210692	TMAO Suppresses Megalin Expression and Albumin Uptake in Human Proximal Tubular Cells Via PI3K and ERK Signaling
GSE211806	Gene expression profiling in hepatocellular carcinoma cell lines PRC/PRF/5 and SNU-449 after a treatment with Transforming Growth Factor beta (TGF-beta) and Galunisertib, alone or in combination
GSE212367	Transcriptomic profiling between attached and detached SAS cells
GSE213313	Serial whole blood transcriptomic analysis demonstrates activation of neutrophils, platelets and coagulation in severe and critical COVID-19 – submitted
GSE214209	Gene expression signatures of JBV cells treated with miR-145
GSE214533	Transcriptomic study of G-1 treatment on GBM cells
GSE215844	Identification of the regulation of circMAN1A2-miRNA in esophageal squamous cell carcinoma.
GSE215845	Differential Gene expression after peroxiredoxin2 downregulation in human extravillous cytotrophoblast-derived cell line HTR8
GSE216880	γδ-T cells and αβ-TCR transduced γδ-T cells
GSE218286	Genome-wide gene expression analysis to find ZDHHC11 targets
GSE222215	Expression of neutrophilic genes in patients diagnosed with Kawasaki disease and healthy controls
GSE223042	Impact of gas plasma-induced chronic oxidative stress on head and neck cancer
GSE223328	Plasma cell infiltration and tissue destruction are hallmarks of Epstein-Barr virus infection in periodontitis
GSE224330	Gene expression of monocytes from rheumatoid arthritis patients treated with bDMARDs and methotrexate.
GSE224785	Expression data from a human primary syncytiotrophoblast model in response to double-stranded RNA
GSE225178	Association of immune related expression profile with sensitivity to neoadjuvant chemotherapy using docetaxel, cisplatin and 5-fluorouracil in esophageal squamous cell carcinoma.
GSE226405	Endothelial DLL4 is an adipose depot specific fasting sensor regulating fatty acid fluxes
GSE226973	Exercise training attenuated the muscle mitochondria genomic response to 70 day bedrest (RNA-Seq)
GSE228740	Alteration of target cleavage patterns and off-target reduction of antisense oligonucleotides incorporating 2-N-carbamoyl- or (2-pyridyl)guanine [MALAT]
GSE228741	Alteration of target cleavage patterns and off-target reduction of antisense oligonucleotides incorporating 2-N-carbamoyl- or (2-pyridyl)guanine [Rluc]
GSE228747	Alteration of target cleavage patterns and off-target reduction of antisense oligonucleotides incorporating 2-N-carbamoyl- or (2-pyridyl)guanine
GSE230056	Differentially expressed genes after transfection of miRNA in a human cancer cell line
GSE230151	Cancer treatment with radiation-chemotherapy rapidly induces molecular pathways for both resistance and new therapeutic targets
GSE230698	Alteration of gene expressions in RCC cell lines co-cultured with HGECs with down-regulated INSR
GSE231505	Expression profile of iPS cells from NEDAMSS patients as well as sibling controls
GSE233764	A hypermethylated ALOX12 gene is highly susceptible to 5-azacytidine treatment in myelodysplastic syndromes
GSE233973	Comprehensive gene expression analysis using gastric mucosa with autoimmune gastritis
GSE234547	Caspase-mediated processing of TRBP regulates apoptosis during viral infection
GSE234549	Caspase-mediated processing of TRBP regulates apoptosis during viral infection
GSE234550	Caspase-mediated processing of TRBP regulates apoptosis during viral infection
GSE234894	Overlapping role of c-Jun N-terminal kinase (JNK) 1 and 2 in imidazole ketone erastin-induced ferroptosis
GSE235020	Transcriptomic profiling between HSC-3 and HSC-3-S5 cells
GSE235635	Mature interleukin-36γ induces stratum corneum exfoliation in generalized pustular psoriasis by suppressing corneodesmosin
GSE235864	Hyaluronic Acid Induction Promotes the Differentiation of Human Neural Crest-like Cells into Periodontal Ligament Stem-like Cells
GSE237277	Comparative analysis of response to treatments and molecular features of tumor- derived organoids versus cell lines and PDX derived from the same clear cell ovarian adenocarcinoma
GSE237847	Vascular calcification is accelerated by hyponatremia and low osmolality condition via activating Rac1-Akt pathway
GSE238179	Transcriptional profiling of intrahepatic cholangiocarcinoma (iCCA) cell lines transfected with GD3S
GSE240792	Changes in gene profiles during the long term culture of human induced pluripotent stem cell-derived cardiomyocytes
GSE240793	human induced pluripotent stem cell-derived cardiomyocytes
GSE240831	Gene expression analysis of primary human vascular wall-derived stem cells (VW-MSCs) and dermal fibroblasts
GSE241312	Investigation of the Mechanism of Action by Comprehensive Transcriptome Analysis
GSE241636	Human induced pluripotent stem cells are resistant to human cytomegalovirus infection primarily at the attachment level due to the reduced expression of cell-surface heparan sulfate
GSE241941	The BHLHE40‒PPM1F‒AMPK pathway regulates energy metabolism and is associated with the aggressiveness of endometrial cancer
GSE242241	Differentially expressed genes after transfection of miRNA in a human cancer cell line (miR-139-5p and miR-139-3p)
GSE244574	Transcriptome analysis of doxorubicin-treated MCF7 breat cancer cells
GSE245118	To elucidate the role of Protein Kinase C in Urothelial Bladder Carcinoma.
GSE245159	Nuclear activating miR-451a induced cetuximab resistance in HNSCC [microarray]
GSE245160	Nuclear miR-451a activates KDM7A and leads to cetuximab resistance in head and neck squamous cell carcinoma
GSE245234	Effects of siERRα on gene expression in human skin fibroblast TIG113 cell.
GSE245707	Splice-switching antisense oligonucleotide controlling tumor suppressor REST is a novel therapeutic medicine for neuroendocrine cancer
GSE246091	The expression of trefoil factor family member 2 in increased at an acidic pH
GSE248026	In vitro throughput screening of anticancer drugs by patient-derived cell lines cultured　on vascularized three-dimensional stromal tissues
GSE248896	An MMSET inhibitor-induced changes in gene expression profile of multiple myeloma cells
GSE250634	Intestinal epithelial cells (RYU) and Mesenchymal stromal cells (LONG)
GSE251639	Blockade of histamine receptor H1 augments immune checkpoint therapy by enhancing MHC-I expression in pancreatic cancer cells
GSE252484	circZDHHC11 knockdown in ST486 cells
GSE252798	Human Platelet Lysate-Cultured Adipose-Derived Stem Cell Sheets Promote Angiogenesis and Accelerate Wound Healing via CCL5 Modulation
GSE253402	Gene Expression Profiles Induced by RNA interference on NSD1 Δ5Δ7, and NSD1 Δ19–23 isoforms in Fibroblast Cells I.
GSE253403	Gene Expression Profiles Induced by RNA interference on NSD1 Δ5Δ7, and NSD1 Δ19–23 isoforms in Fibroblast Cells II.
GSE253404	Gene Expression Profiles Induced by RNA interference on NSD1 Δ5Δ7, and NSD1 Δ19–23 isoforms in Fibroblast Cells III.
GSE253489	Gene expression of myeloma cell lines with miR-7 transduction
GSE253496	Identification of Antiviral Host Factors by Functional Gene Expression Analysis using HBV Infection Assay Systems
GSE253566	Paving the way to a neural fate - RNA signatures in naive and trans-differentiating Mesenchymal Stem Cells - transcriptome data
GSE253567	Paving the way to a neural fate - RNA signatures in naive and trans-differentiating Mesenchymal Stem Cells
GSE254052	A network-based trans-omics approach for predicting synergistic drug combinations
GSE256247	CD99 contributes to the EWS:FLI transcriptome by specifically affecting FOXM1-targets involved in the G2/M cell cycle phase
GSE267216	Transcriptional changes in A549 cells after four weeks of exposure to 30 μg/ml diesel exhaust particles measured by Agilent SurePrint G3 Human Gene Expression Microarray.
GSE267217	Long-term exposure to diesel exhaust particles induces concordant changes in DNA methylation and transcriptome in human adenocarcinoma alveolar basal epithelial cells
GSE269654	The amniote-conserved DNA-binding domain of CGGBP1 restricts cytosine methylation of transcription factor binding sites in proximal promoters to regulate gene expression
GSE269880	Tretinoin synergistically enhances the antitumor effect of combined BRAF, MEK, and EGFR inhibition in BRAFV600E colorectal cancer [RKO samples]
GSE269881	Tretinoin synergistically enhances the antitumor effect of combined BRAF, MEK, and EGFR inhibition in BRAFV600E colorectal cancer [HT29 samples]
GSE271083	Activation-induced cytidine deaminase induces DNA demethylation and expression of Ninjurin-2 gene
GSE274532	Porphyromonas gingivalis triggers microglia activation and neurodegenerative processes through NOX4
GSE274812	Gene expression analysis of cervical cancer cells transfected with siRNAs against either HPV E6 or E6/E7
GSE276428	Gene Expression Profiles Associated with Mφ Spatial Aggregation for HCC
GSE280961	Gene expression changes upon CD63 knockdown in esophageal squamous cell carcinoma cell lines

Relations

Alternative to

GPL20844 (Feature Number Version)

Data table header descriptions
ID	Agilent Probe Name
CONTROL_TYPE	Control type
REFSEQ	RefSeqAccession
GB_ACC	GenBankAccession
LOCUSLINK_ID	LocuslinkID
GENE_SYMBOL	Gene Symbol
GENE_NAME	Gene Name
UNIGENE_ID	UnigeneID
ENSEMBL_ID	EnsemblID
ACCESSION_STRING	Accession String
CHROMOSOMAL_LOCATION	Chromosomal Location
CYTOBAND	Cytoband
DESCRIPTION	Description
GO_ID	GoIDs
SEQUENCE	Sequence
SPOT_ID	Spot identifier

Data table

CONTROL_TYPE

REFSEQ

GB_ACC

LOCUSLINK_ID

GENE_SYMBOL

GENE_NAME

UNIGENE_ID

ENSEMBL_ID

ACCESSION_STRING

CHROMOSOMAL_LOCATION

CYTOBAND

DESCRIPTION

GO_ID

SEQUENCE

SPOT_ID

GE_BrightCorner

pos

GE_BrightCorner

DarkCorner

pos

DarkCorner

A_21_P0014386

FALSE

unmapped

AATACATGTTTTGGTAAACACTCGGTCAGAGCACCCTCTTTCTGTGGAATCAGACTGGCA

A_21_P0014386

A_33_P3396872

FALSE

NM_001105533

79974

CPED1

cadherin-like and PC-esterase domain containing 1

Hs.189652

ref|NM_001105533|gb|AK025639|gb|BC030538|tc|THC2601673

chr7:120901888-120901947

hs|7q31.31

Homo sapiens cadherin-like and PC-esterase domain containing 1 (CPED1), transcript variant 2, mRNA [NM_001105533]

GO:0005783(endoplasmic reticulum)

GCTTATCTCACCTAATACAGGGACTATGCAACCAAGAAACTGGAAATAAAAACAAAGATA

A_33_P3396872

A_33_P3267760

FALSE

54880

BCOR

BCL6 corepressor

ENST00000378463

ens|ENST00000378463

chrX:39909128-39909069

hs|Xp11.4

BCL6 corepressor [Source:HGNC Symbol;Acc:HGNC:20893] [ENST00000378463]

GO:0000122(negative regulation of transcription from RNA polymerase II promoter)|GO:0000415(negative regulation of histone H3-K36 methylation)|GO:0003714(transcription corepressor activity)|GO:0004842(ubiquitin-protein ligase activity)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0006351(transcription, DNA-dependent)|GO:0007507(heart development)|GO:0008134(transcription factor binding)|GO:0030502(negative regulation of bone mineralization)|GO:0031072(heat shock protein binding)|GO:0031519(PcG protein complex)|GO:0035518(histone H2A monoubiquitination)|GO:0042476(odontogenesis)|GO:0042826(histone deacetylase binding)|GO:0044212(transcription regulatory region DNA binding)|GO:0045892(negative regulation of transcription, DNA-dependent)|GO:0051572(negative regulation of histone H3-K4 methylation)|GO:0060021(palate development)|GO:0065001(specification of axis polarity)|GO:0070171(negative regulation of tooth mineralization)

CATCAAAGCTACGAGAGATCCTACACACCCAGATTTAAAAAATAATAAAAACTTAAGGGC

A_33_P3267760

A_32_P194264

FALSE

NM_001008708

494143

CHAC2

ChaC, cation transport regulator homolog 2 (E. coli)

Hs.585944

ENST00000295304

ref|NM_001008708|ens|ENST00000295304|gb|HQ447717|gb|BC017941

chr2:54001454-54001513

hs|2p16.2

Homo sapiens ChaC, cation transport regulator homolog 2 (E. coli) (CHAC2), mRNA [NM_001008708]

GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0008150(biological_process)|GO:0008152(metabolic process)|GO:0016746(transferase activity, transferring acyl groups)

CTGATTATCTTGGTCCTGCACCTCTGGAAGACATTGCTGAACAAATTCTTAATGCAGCTG

A_32_P194264

A_23_P153745

FALSE

NM_006332

10437

IFI30

interferon, gamma-inducible protein 30

Hs.14623

ENST00000593731

ref|NM_006332|ens|ENST00000593731|ens|ENST00000600463|ens|ENST00000407280

chr19:18288840-18288899

hs|19p13.11

Homo sapiens interferon, gamma-inducible protein 30 (IFI30), mRNA [NM_006332]

GO:0005576(extracellular region)|GO:0005737(cytoplasm)|GO:0005764(lysosome)|GO:0005886(plasma membrane)|GO:0016667(oxidoreductase activity, acting on a sulfur group of donors)|GO:0019221(cytokine-mediated signaling pathway)|GO:0019886(antigen processing and presentation of exogenous peptide antigen via MHC class II)|GO:0030054(cell junction)|GO:0042590(antigen processing and presentation of exogenous peptide antigen via MHC class I)|GO:0043202(lysosomal lumen)|GO:0043231(intracellular membrane-bounded organelle)|GO:0048147(negative regulation of fibroblast proliferation)|GO:0050821(protein stabilization)|GO:0055114(oxidation-reduction process)|GO:0060333(interferon-gamma-mediated signaling pathway)

ATGAAGCCCAGATACACAAAATTCCACCCCTAGATCAAGAATCCTGCTCCACTAAGAATG

A_23_P153745

A_33_P3352837

FALSE

chr2:171521262-171521203

hs|2q31.1

TTAGTTGTTCCGGTTACACAAGGCTGCTTAGAATGTGGGAGCAGGAAGGCTTTCTCTAAA

A_33_P3352837

A_21_P0011260

FALSE

Hs.592320

ENST00000618272

ens|ENST00000618272|linc|TCONS_l2_00007928|gb|BI821606|tc|THC2662262

chr14:103675125-103675184

hs|14q32.32

603036639F1 NIH_MGC_115 Homo sapiens cDNA clone IMAGE:5177672 5', mRNA sequence [BI821606]

CAGCTGCAACATATTTTTCAAATTTAGGAACCCAACTTAACCATCTGAACATCCTTCTTA

A_21_P0011260

A_33_P3235816

FALSE

BX647611

Hs.594815

ENST00000436258

ens|ENST00000436258|gb|BX647611|tc|THC2646539

chr7:35129516-35129457

hs|7p14.2

DPY19L2 pseudogene 1 [Source:HGNC Symbol;Acc:HGNC:22305] [ENST00000436258]

ATTCCTAATTAAAATTTTTTAATTTCTGAATTTTGAATCTCTAAAAATCATAAAATTCTA

A_33_P3235816

A_21_P0014180

FALSE

XM_006715643

115330

GPR146

G protein-coupled receptor 146

ENST00000474396

ens|ENST00000474396|tc|THC2637218

chr7:1095841-1095900

hs|7p22.3

G protein-coupled receptor 146 [Source:HGNC Symbol;Acc:HGNC:21718] [ENST00000474396]

GO:0004930(G-protein coupled receptor activity)|GO:0005886(plasma membrane)|GO:0007186(G-protein coupled receptor signaling pathway)|GO:0016021(integral to membrane)

TGCTGGTCAAGATGTGTTAGTGAGGAGCTAGACAAGATGAGCACGTGAGAAGCAGGGGCC

A_21_P0014180

A_24_P944991

FALSE

NM_173829

285672

SREK1IP1

SREK1-interacting protein 1

Hs.69504

ENST00000513458

ref|NM_173829|ens|ENST00000513458|gb|BC127085|gb|BC127086

chr5:64018946-64018887

hs|5q12.3

Homo sapiens SREK1-interacting protein 1 (SREK1IP1), mRNA [NM_173829]

GO:0003676(nucleic acid binding)|GO:0006397(mRNA processing)|GO:0008270(zinc ion binding)|GO:0008380(RNA splicing)

TAGGTAGCCCTTATGTCCACTAAAGTAAATGCTTATGTTGTAGAAGCATCGAACATCAAC

A_24_P944991

A_21_P0006507

FALSE

lnc-ARMCX4-1

lnc-ARMCX4-1:1

linc|lnc-ARMCX4-1:1|linc|TCONS_00017209

chrX:100672726-100672785

hs|Xq22.1

LNCipedia lincRNA (lnc-ARMCX4-1), lincRNA [lnc-ARMCX4-1:1]

AATGCTCTGACCGATACATTCTTTAGAACATCTACCCGTACATTCCAAGGACCCTTTTTC

A_21_P0006507

A_23_P208706

FALSE

NM_138764

581

BAX

BCL2-associated X protein

Hs.624291

ref|NM_138764|ref|NM_001291428|ref|NM_001291431|ref|NM_138761

chr19:49464904-49464963

hs|19q13.33

Homo sapiens BCL2-associated X protein (BAX), transcript variant sigma, mRNA [NM_138764]

GO:0001541(ovarian follicle development)|GO:0001764(neuron migration)|GO:0001777(T cell homeostatic proliferation)|GO:0001782(B cell homeostasis)|GO:0001783(B cell apoptotic process)|GO:0001822(kidney development)|GO:0001836(release of cytochrome c from mitochondria)|GO:0001844(protein insertion into mitochondrial membrane involved in apoptotic signaling pathway)|GO:0001974(blood vessel remodeling)|GO:0002262(myeloid cell homeostasis)|GO:0002352(B cell negative selection)|GO:0002358(B cell homeostatic proliferation)|GO:0002904(positive regulation of B cell apoptotic process)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005635(nuclear envelope)|GO:0005739(mitochondrion)|GO:0005741(mitochondrial outer membrane)|GO:0005757(mitochondrial permeability transition pore complex)|GO:0005783(endoplasmic reticulum)|GO:0005789(endoplasmic reticulum membrane)|GO:0005829(cytosol)|GO:0006687(glycosphingolipid metabolic process)|GO:0006808(regulation of nitrogen utilization)|GO:0006915(apoptotic process)|GO:0006919(activation of cysteine-type endopeptidase activity involved in apoptotic process)|GO:0006927(transformed cell apoptotic process)|GO:0007281(germ cell development)|GO:0008053(mitochondrial fusion)|GO:0008289(lipid binding)|GO:0008625(induction of apoptosis via death domain receptors)|GO:0008630(DNA damage response, signal transduction resulting in induction of apoptosis)|GO:0008635(activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c)|GO:0008637(apoptotic mitochondrial changes)|GO:0009566(fertilization)|GO:0009636(response to toxin)|GO:0009651(response to salt stress)|GO:0010248(establishment or maintenance of transmembrane electrochemical gradient)|GO:0010332(response to gamma radiation)|GO:0015267(channel activity)|GO:0016020(membrane)|GO:0016032(viral reproduction)|GO:0021854(hypothalamus development)|GO:0021987(cerebral cortex development)|GO:0032091(negative regulation of protein binding)|GO:0032461(positive regulation of protein oligomerization)|GO:0032469(endoplasmic reticulum calcium ion homeostasis)|GO:0032471(reduction of endoplasmic reticulum calcium ion concentration)|GO:0032976(release of matrix enzymes from mitochondria)|GO:0033137(negative regulation of peptidyl-serine phosphorylation)|GO:0033599(regulation of mammary gland epithelial cell proliferation)|GO:0034644(cellular response to UV)|GO:0035234(germ cell programmed cell death)|GO:0042475(odontogenesis of dentin-containing tooth)|GO:0042802(identical protein binding)|GO:0042803(protein homodimerization activity)|GO:0043065(positive regulation of apoptotic process)|GO:0043496(regulation of protein homodimerization activity)|GO:0043497(regulation of protein heterodimerization activity)|GO:0043524(negative regulation of neuron apoptotic process)|GO:0043525(positive regulation of neuron apoptotic process)|GO:0043653(mitochondrial fragmentation involved in apoptotic process)|GO:0045136(development of secondary sexual characteristics)|GO:0046666(retinal cell programmed cell death)|GO:0046930(pore complex)|GO:0046982(protein heterodimerization activity)|GO:0048087(positive regulation of developmental pigmentation)

TGCCTTGGACTGTGTTTTTCCTCCATAAATTATGGCATTTTTCTGGGAGGGGTGGGGATT

A_23_P208706

A_33_P3388806

FALSE

NM_001199327

100526835

FPGT-TNNI3K

FPGT-TNNI3K readthrough

Hs.480085

ENST00000370899

ref|NM_001199327|gb|BC032865|ens|ENST00000370899|tc|THC2476487

chr1:74930515-74930574

hs|1p31.1

Homo sapiens FPGT-TNNI3K readthrough (FPGT-TNNI3K), transcript variant 2, mRNA [NM_001199327]

CGGTCCTTTTTGTTTATTTTGTTCACTGCTATAACACTAACATCTAAAGCTGGATGCTTA

A_33_P3388806

A_33_P3324839

FALSE

NM_006772

8831

SYNGAP1

synaptic Ras GTPase activating protein 1

Hs.586264

ENST00000418600

ref|NM_006772|ens|ENST00000418600|ens|ENST00000455687|gb|AL713634

chr6:33420559-33420618

hs|6p21.32

Homo sapiens synaptic Ras GTPase activating protein 1 (SYNGAP1), mRNA [NM_006772]

GO:0005097(Rab GTPase activator activity)|GO:0005099(Ras GTPase activator activity)|GO:0005737(cytoplasm)|GO:0007265(Ras protein signal transduction)|GO:0007389(pattern specification process)|GO:0008542(visual learning)|GO:0016358(dendrite development)|GO:0017124(SH3 domain binding)|GO:0031235(intrinsic to internal side of plasma membrane)|GO:0032320(positive regulation of Ras GTPase activity)|GO:0032851(positive regulation of Rab GTPase activity)|GO:0043113(receptor clustering)|GO:0043198(dendritic shaft)|GO:0043408(regulation of MAPK cascade)|GO:0043524(negative regulation of neuron apoptotic process)|GO:0046580(negative regulation of Ras protein signal transduction)|GO:0048167(regulation of synaptic plasticity)|GO:0048169(regulation of long-term neuronal synaptic plasticity)|GO:0050771(negative regulation of axonogenesis)|GO:0050803(regulation of synapse structure and activity)

TTGGTCTCTACTCCCAGGGGGAGGGGGGAACTTACTCTAGGAAAAGCCATGTCTCTCTCC

A_33_P3324839

A_24_P333494

FALSE

NM_018994

54455

FBXO42

F-box protein 42

Hs.522384

ENST00000375592

ref|NM_018994|ens|ENST00000375592|ref|XM_006710698|gb|BC006174

chr1:16577198-16577139

hs|1p36.13

Homo sapiens F-box protein 42 (FBXO42), mRNA [NM_018994]

AAACGCCTTGTACTTTGTACGAGCAAAGAGATAATGTGTTCTAAACCCCTTTCCTTTTCT

A_24_P333494

A_22_P00006274

FALSE

NR_109772

101927502

LOC101927502

uncharacterized LOC101927502

Hs.528628

ENST00000413050

ref|NR_109772|ens|ENST00000413050|ens|ENST00000437181|linc|lnc-FAM75D1-1:3

chr9:84362930-84362989

hs|9q21.32

Homo sapiens uncharacterized LOC101927502 (LOC101927502), long non-coding RNA [NR_109772]

AATAAGCAAAGATTCGCACCTCTAGCCTCCGGGGAGCTTAATCTTCTGCTACAACATTTG

A_22_P00006274

A_23_P161615

FALSE

AK307831

23649

POLA2

polymerase (DNA directed), alpha 2, accessory subunit

Hs.201897

ENST00000534785

ens|ENST00000534785|ens|ENST00000527618|ens|ENST00000527850|gb|AK307831

chr11:65062111-65063057

hs|11q13.1

polymerase (DNA directed), alpha 2, accessory subunit [Source:HGNC Symbol;Acc:HGNC:30073] [ENST00000534785]

GO:0000060(protein import into nucleus, translocation)|GO:0000082(G1/S transition of mitotic cell cycle)|GO:0000278(mitotic cell cycle)|GO:0000722(telomere maintenance via recombination)|GO:0000723(telomere maintenance)|GO:0003674(molecular_function)|GO:0003677(DNA binding)|GO:0003887(DNA-directed DNA polymerase activity)|GO:0005654(nucleoplasm)|GO:0005658(alpha DNA polymerase:primase complex)|GO:0005737(cytoplasm)|GO:0006260(DNA replication)|GO:0006270(DNA-dependent DNA replication initiation)|GO:0006271(DNA strand elongation involved in DNA replication)|GO:0032201(telomere maintenance via semi-conservative replication)|GO:0046982(protein heterodimerization activity)|GO:0071897(DNA biosynthetic process)

AGGAGATCAGTAGTTCTTCCGGAACTTCAGACAGATTCAGCCGAATACTCAAGCACATCT

A_23_P161615

A_33_P3384958

FALSE

NM_014839

9890

LPPR4

lipid phosphate phosphatase-related protein type 4

Hs.13245

ENST00000457765

ref|NM_014839|ref|NM_001166252|ens|ENST00000457765|ens|ENST00000370185

chr1:99771632-99771691

hs|1p21.2

Homo sapiens lipid phosphate phosphatase-related protein type 4 (LPPR4), transcript variant 1, mRNA [NM_014839]

ATAAGAATGAAAGTCGAAAGTTGTCCTTGCAAGTTATAGAGCCTGAGCCTGGGCAGTCAC

A_33_P3384958

Total number of rows: 58341

Table truncated, full table size 32107 Kbytes.

Download family	Format
SOFT formatted family file(s)	SOFT
MINiML formatted family file(s)	MINiML

Supplementary data files not provided