NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL21185 Query DataSets for GPL21185
Status Public on Nov 30, 2015
Title Agilent-072363 SurePrint G3 Human GE v3 8x60K Microarray 039494 [Probe Name Version]
Technology type in situ oligonucleotide
Distribution commercial
Organism Homo sapiens
Manufacturer Agilent Technologies
Manufacture protocol see manufacturer's web site at http://www.agilent.com/
 
Description Catalog gene expression microarray for Human, v3 8x60K

Arrays of this design have barcodes that begin with 16072363 or 2572363.
 
Submission date Nov 30, 2015
Last update date Feb 20, 2018
Organization Agilent Technologies
E-mail(s) cag_sales-na@agilent.com
Phone 877-424-4536
URL http://www.agilent.com
Department
Street address
City Palo Alto
State/province CA
ZIP/Postal code 94304
Country USA
 
Samples (4809) GSM1966830, GSM1966831, GSM1966832, GSM1966833, GSM1966834, GSM1966835 
Series (371)
GSE66244 Identification of expresion patterns after treatment with GC/RA and combination with AZA/SAHA in MYC amplified and BRG1 mutant lung cancer cell lines
GSE66245 Treatment with GC/RA and combination with AZA/SAHA in MYC amplified and BRG1 mutant lung cancer cell lines
GSE75755 siRNA knockdown of GALNT2 in gastric adenocarcinoma AGS cells
Relations
Alternative to GPL20844 (Feature Number Version)

Data table header descriptions
ID Agilent Probe Name
CONTROL_TYPE Control type
REFSEQ RefSeqAccession
GB_ACC GenBankAccession
LOCUSLINK_ID LocuslinkID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE Sequence
SPOT_ID Spot identifier

Data table
ID CONTROL_TYPE REFSEQ GB_ACC LOCUSLINK_ID GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE SPOT_ID
GE_BrightCorner pos GE_BrightCorner
DarkCorner pos DarkCorner
A_21_P0014386 FALSE unmapped AATACATGTTTTGGTAAACACTCGGTCAGAGCACCCTCTTTCTGTGGAATCAGACTGGCA A_21_P0014386
A_33_P3396872 FALSE NM_001105533 NM_001105533 79974 CPED1 cadherin-like and PC-esterase domain containing 1 Hs.189652 ref|NM_001105533|gb|AK025639|gb|BC030538|tc|THC2601673 chr7:120901888-120901947 hs|7q31.31 Homo sapiens cadherin-like and PC-esterase domain containing 1 (CPED1), transcript variant 2, mRNA [NM_001105533] GO:0005783(endoplasmic reticulum) GCTTATCTCACCTAATACAGGGACTATGCAACCAAGAAACTGGAAATAAAAACAAAGATA A_33_P3396872
A_33_P3267760 FALSE 54880 BCOR BCL6 corepressor ENST00000378463 ens|ENST00000378463 chrX:39909128-39909069 hs|Xp11.4 BCL6 corepressor [Source:HGNC Symbol;Acc:HGNC:20893] [ENST00000378463] GO:0000122(negative regulation of transcription from RNA polymerase II promoter)|GO:0000415(negative regulation of histone H3-K36 methylation)|GO:0003714(transcription corepressor activity)|GO:0004842(ubiquitin-protein ligase activity)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0006351(transcription, DNA-dependent)|GO:0007507(heart development)|GO:0008134(transcription factor binding)|GO:0030502(negative regulation of bone mineralization)|GO:0031072(heat shock protein binding)|GO:0031519(PcG protein complex)|GO:0035518(histone H2A monoubiquitination)|GO:0042476(odontogenesis)|GO:0042826(histone deacetylase binding)|GO:0044212(transcription regulatory region DNA binding)|GO:0045892(negative regulation of transcription, DNA-dependent)|GO:0051572(negative regulation of histone H3-K4 methylation)|GO:0060021(palate development)|GO:0065001(specification of axis polarity)|GO:0070171(negative regulation of tooth mineralization) CATCAAAGCTACGAGAGATCCTACACACCCAGATTTAAAAAATAATAAAAACTTAAGGGC A_33_P3267760
A_32_P194264 FALSE NM_001008708 NM_001008708 494143 CHAC2 ChaC, cation transport regulator homolog 2 (E. coli) Hs.585944 ENST00000295304 ref|NM_001008708|ens|ENST00000295304|gb|HQ447717|gb|BC017941 chr2:54001454-54001513 hs|2p16.2 Homo sapiens ChaC, cation transport regulator homolog 2 (E. coli) (CHAC2), mRNA [NM_001008708] GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0008150(biological_process)|GO:0008152(metabolic process)|GO:0016746(transferase activity, transferring acyl groups) CTGATTATCTTGGTCCTGCACCTCTGGAAGACATTGCTGAACAAATTCTTAATGCAGCTG A_32_P194264
A_23_P153745 FALSE NM_006332 NM_006332 10437 IFI30 interferon, gamma-inducible protein 30 Hs.14623 ENST00000593731 ref|NM_006332|ens|ENST00000593731|ens|ENST00000600463|ens|ENST00000407280 chr19:18288840-18288899 hs|19p13.11 Homo sapiens interferon, gamma-inducible protein 30 (IFI30), mRNA [NM_006332] GO:0005576(extracellular region)|GO:0005737(cytoplasm)|GO:0005764(lysosome)|GO:0005886(plasma membrane)|GO:0016667(oxidoreductase activity, acting on a sulfur group of donors)|GO:0019221(cytokine-mediated signaling pathway)|GO:0019886(antigen processing and presentation of exogenous peptide antigen via MHC class II)|GO:0030054(cell junction)|GO:0042590(antigen processing and presentation of exogenous peptide antigen via MHC class I)|GO:0043202(lysosomal lumen)|GO:0043231(intracellular membrane-bounded organelle)|GO:0048147(negative regulation of fibroblast proliferation)|GO:0050821(protein stabilization)|GO:0055114(oxidation-reduction process)|GO:0060333(interferon-gamma-mediated signaling pathway) ATGAAGCCCAGATACACAAAATTCCACCCCTAGATCAAGAATCCTGCTCCACTAAGAATG A_23_P153745
A_33_P3352837 FALSE chr2:171521262-171521203 hs|2q31.1 TTAGTTGTTCCGGTTACACAAGGCTGCTTAGAATGTGGGAGCAGGAAGGCTTTCTCTAAA A_33_P3352837
A_21_P0011260 FALSE Hs.592320 ENST00000618272 ens|ENST00000618272|linc|TCONS_l2_00007928|gb|BI821606|tc|THC2662262 chr14:103675125-103675184 hs|14q32.32 603036639F1 NIH_MGC_115 Homo sapiens cDNA clone IMAGE:5177672 5', mRNA sequence [BI821606] CAGCTGCAACATATTTTTCAAATTTAGGAACCCAACTTAACCATCTGAACATCCTTCTTA A_21_P0011260
A_33_P3235816 FALSE BX647611 Hs.594815 ENST00000436258 ens|ENST00000436258|gb|BX647611|tc|THC2646539 chr7:35129516-35129457 hs|7p14.2 DPY19L2 pseudogene 1 [Source:HGNC Symbol;Acc:HGNC:22305] [ENST00000436258] ATTCCTAATTAAAATTTTTTAATTTCTGAATTTTGAATCTCTAAAAATCATAAAATTCTA A_33_P3235816
A_21_P0014180 FALSE XM_006715643 115330 GPR146 G protein-coupled receptor 146 ENST00000474396 ens|ENST00000474396|tc|THC2637218 chr7:1095841-1095900 hs|7p22.3 G protein-coupled receptor 146 [Source:HGNC Symbol;Acc:HGNC:21718] [ENST00000474396] GO:0004930(G-protein coupled receptor activity)|GO:0005886(plasma membrane)|GO:0007186(G-protein coupled receptor signaling pathway)|GO:0016021(integral to membrane) TGCTGGTCAAGATGTGTTAGTGAGGAGCTAGACAAGATGAGCACGTGAGAAGCAGGGGCC A_21_P0014180
A_24_P944991 FALSE NM_173829 NM_173829 285672 SREK1IP1 SREK1-interacting protein 1 Hs.69504 ENST00000513458 ref|NM_173829|ens|ENST00000513458|gb|BC127085|gb|BC127086 chr5:64018946-64018887 hs|5q12.3 Homo sapiens SREK1-interacting protein 1 (SREK1IP1), mRNA [NM_173829] GO:0003676(nucleic acid binding)|GO:0006397(mRNA processing)|GO:0008270(zinc ion binding)|GO:0008380(RNA splicing) TAGGTAGCCCTTATGTCCACTAAAGTAAATGCTTATGTTGTAGAAGCATCGAACATCAAC A_24_P944991
A_21_P0006507 FALSE lnc-ARMCX4-1 lnc-ARMCX4-1:1 linc|lnc-ARMCX4-1:1|linc|TCONS_00017209 chrX:100672726-100672785 hs|Xq22.1 LNCipedia lincRNA (lnc-ARMCX4-1), lincRNA [lnc-ARMCX4-1:1] AATGCTCTGACCGATACATTCTTTAGAACATCTACCCGTACATTCCAAGGACCCTTTTTC A_21_P0006507
A_23_P208706 FALSE NM_138764 NM_138764 581 BAX BCL2-associated X protein Hs.624291 ref|NM_138764|ref|NM_001291428|ref|NM_001291431|ref|NM_138761 chr19:49464904-49464963 hs|19q13.33 Homo sapiens BCL2-associated X protein (BAX), transcript variant sigma, mRNA [NM_138764] GO:0001541(ovarian follicle development)|GO:0001764(neuron migration)|GO:0001777(T cell homeostatic proliferation)|GO:0001782(B cell homeostasis)|GO:0001783(B cell apoptotic process)|GO:0001822(kidney development)|GO:0001836(release of cytochrome c from mitochondria)|GO:0001844(protein insertion into mitochondrial membrane involved in apoptotic signaling pathway)|GO:0001974(blood vessel remodeling)|GO:0002262(myeloid cell homeostasis)|GO:0002352(B cell negative selection)|GO:0002358(B cell homeostatic proliferation)|GO:0002904(positive regulation of B cell apoptotic process)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005635(nuclear envelope)|GO:0005739(mitochondrion)|GO:0005741(mitochondrial outer membrane)|GO:0005757(mitochondrial permeability transition pore complex)|GO:0005783(endoplasmic reticulum)|GO:0005789(endoplasmic reticulum membrane)|GO:0005829(cytosol)|GO:0006687(glycosphingolipid metabolic process)|GO:0006808(regulation of nitrogen utilization)|GO:0006915(apoptotic process)|GO:0006919(activation of cysteine-type endopeptidase activity involved in apoptotic process)|GO:0006927(transformed cell apoptotic process)|GO:0007281(germ cell development)|GO:0008053(mitochondrial fusion)|GO:0008289(lipid binding)|GO:0008625(induction of apoptosis via death domain receptors)|GO:0008630(DNA damage response, signal transduction resulting in induction of apoptosis)|GO:0008635(activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c)|GO:0008637(apoptotic mitochondrial changes)|GO:0009566(fertilization)|GO:0009636(response to toxin)|GO:0009651(response to salt stress)|GO:0010248(establishment or maintenance of transmembrane electrochemical gradient)|GO:0010332(response to gamma radiation)|GO:0015267(channel activity)|GO:0016020(membrane)|GO:0016032(viral reproduction)|GO:0021854(hypothalamus development)|GO:0021987(cerebral cortex development)|GO:0032091(negative regulation of protein binding)|GO:0032461(positive regulation of protein oligomerization)|GO:0032469(endoplasmic reticulum calcium ion homeostasis)|GO:0032471(reduction of endoplasmic reticulum calcium ion concentration)|GO:0032976(release of matrix enzymes from mitochondria)|GO:0033137(negative regulation of peptidyl-serine phosphorylation)|GO:0033599(regulation of mammary gland epithelial cell proliferation)|GO:0034644(cellular response to UV)|GO:0035234(germ cell programmed cell death)|GO:0042475(odontogenesis of dentin-containing tooth)|GO:0042802(identical protein binding)|GO:0042803(protein homodimerization activity)|GO:0043065(positive regulation of apoptotic process)|GO:0043496(regulation of protein homodimerization activity)|GO:0043497(regulation of protein heterodimerization activity)|GO:0043524(negative regulation of neuron apoptotic process)|GO:0043525(positive regulation of neuron apoptotic process)|GO:0043653(mitochondrial fragmentation involved in apoptotic process)|GO:0045136(development of secondary sexual characteristics)|GO:0046666(retinal cell programmed cell death)|GO:0046930(pore complex)|GO:0046982(protein heterodimerization activity)|GO:0048087(positive regulation of developmental pigmentation) TGCCTTGGACTGTGTTTTTCCTCCATAAATTATGGCATTTTTCTGGGAGGGGTGGGGATT A_23_P208706
A_33_P3388806 FALSE NM_001199327 NM_001199327 100526835 FPGT-TNNI3K FPGT-TNNI3K readthrough Hs.480085 ENST00000370899 ref|NM_001199327|gb|BC032865|ens|ENST00000370899|tc|THC2476487 chr1:74930515-74930574 hs|1p31.1 Homo sapiens FPGT-TNNI3K readthrough (FPGT-TNNI3K), transcript variant 2, mRNA [NM_001199327] CGGTCCTTTTTGTTTATTTTGTTCACTGCTATAACACTAACATCTAAAGCTGGATGCTTA A_33_P3388806
A_33_P3324839 FALSE NM_006772 NM_006772 8831 SYNGAP1 synaptic Ras GTPase activating protein 1 Hs.586264 ENST00000418600 ref|NM_006772|ens|ENST00000418600|ens|ENST00000455687|gb|AL713634 chr6:33420559-33420618 hs|6p21.32 Homo sapiens synaptic Ras GTPase activating protein 1 (SYNGAP1), mRNA [NM_006772] GO:0005097(Rab GTPase activator activity)|GO:0005099(Ras GTPase activator activity)|GO:0005737(cytoplasm)|GO:0007265(Ras protein signal transduction)|GO:0007389(pattern specification process)|GO:0008542(visual learning)|GO:0016358(dendrite development)|GO:0017124(SH3 domain binding)|GO:0031235(intrinsic to internal side of plasma membrane)|GO:0032320(positive regulation of Ras GTPase activity)|GO:0032851(positive regulation of Rab GTPase activity)|GO:0043113(receptor clustering)|GO:0043198(dendritic shaft)|GO:0043408(regulation of MAPK cascade)|GO:0043524(negative regulation of neuron apoptotic process)|GO:0046580(negative regulation of Ras protein signal transduction)|GO:0048167(regulation of synaptic plasticity)|GO:0048169(regulation of long-term neuronal synaptic plasticity)|GO:0050771(negative regulation of axonogenesis)|GO:0050803(regulation of synapse structure and activity) TTGGTCTCTACTCCCAGGGGGAGGGGGGAACTTACTCTAGGAAAAGCCATGTCTCTCTCC A_33_P3324839
A_24_P333494 FALSE NM_018994 NM_018994 54455 FBXO42 F-box protein 42 Hs.522384 ENST00000375592 ref|NM_018994|ens|ENST00000375592|ref|XM_006710698|gb|BC006174 chr1:16577198-16577139 hs|1p36.13 Homo sapiens F-box protein 42 (FBXO42), mRNA [NM_018994] AAACGCCTTGTACTTTGTACGAGCAAAGAGATAATGTGTTCTAAACCCCTTTCCTTTTCT A_24_P333494
A_22_P00006274 FALSE NR_109772 NR_109772 101927502 LOC101927502 uncharacterized LOC101927502 Hs.528628 ENST00000413050 ref|NR_109772|ens|ENST00000413050|ens|ENST00000437181|linc|lnc-FAM75D1-1:3 chr9:84362930-84362989 hs|9q21.32 Homo sapiens uncharacterized LOC101927502 (LOC101927502), long non-coding RNA [NR_109772] AATAAGCAAAGATTCGCACCTCTAGCCTCCGGGGAGCTTAATCTTCTGCTACAACATTTG A_22_P00006274
A_23_P161615 FALSE AK307831 23649 POLA2 polymerase (DNA directed), alpha 2, accessory subunit Hs.201897 ENST00000534785 ens|ENST00000534785|ens|ENST00000527618|ens|ENST00000527850|gb|AK307831 chr11:65062111-65063057 hs|11q13.1 polymerase (DNA directed), alpha 2, accessory subunit [Source:HGNC Symbol;Acc:HGNC:30073] [ENST00000534785] GO:0000060(protein import into nucleus, translocation)|GO:0000082(G1/S transition of mitotic cell cycle)|GO:0000278(mitotic cell cycle)|GO:0000722(telomere maintenance via recombination)|GO:0000723(telomere maintenance)|GO:0003674(molecular_function)|GO:0003677(DNA binding)|GO:0003887(DNA-directed DNA polymerase activity)|GO:0005654(nucleoplasm)|GO:0005658(alpha DNA polymerase:primase complex)|GO:0005737(cytoplasm)|GO:0006260(DNA replication)|GO:0006270(DNA-dependent DNA replication initiation)|GO:0006271(DNA strand elongation involved in DNA replication)|GO:0032201(telomere maintenance via semi-conservative replication)|GO:0046982(protein heterodimerization activity)|GO:0071897(DNA biosynthetic process) AGGAGATCAGTAGTTCTTCCGGAACTTCAGACAGATTCAGCCGAATACTCAAGCACATCT A_23_P161615
A_33_P3384958 FALSE NM_014839 NM_014839 9890 LPPR4 lipid phosphate phosphatase-related protein type 4 Hs.13245 ENST00000457765 ref|NM_014839|ref|NM_001166252|ens|ENST00000457765|ens|ENST00000370185 chr1:99771632-99771691 hs|1p21.2 Homo sapiens lipid phosphate phosphatase-related protein type 4 (LPPR4), transcript variant 1, mRNA [NM_014839] GO:0005887(integral to plasma membrane)|GO:0007409(axonogenesis)|GO:0008195(phosphatidate phosphatase activity)|GO:0042577(lipid phosphatase activity)|GO:0046839(phospholipid dephosphorylation)|GO:0048839(inner ear development) ATAAGAATGAAAGTCGAAAGTTGTCCTTGCAAGTTATAGAGCCTGAGCCTGGGCAGTCAC A_33_P3384958

Total number of rows: 58341

Table truncated, full table size 32107 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap