GEO Profile Links for Gene (Select 16512) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 291096791.

Kcnh3 - Mammary epithelial stem cells (MG-430B)

Annotation:: Kcnh3, potassium voltage-gated channel, subfamily H (eag-related), member 3

Organism:: Mus musculus

Reporter:: GPL340, 1459107_at (ID_REF), GDS2254, 16512 (Gene ID), BG069378

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 29109679

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 335503792.

Kcnh3 - Ras-associated binding protein 3A mutations effect on brain cortices and hippocampi (MG-430B)

Annotation:: Kcnh3, potassium voltage-gated channel, subfamily H (eag-related), member 3

Organism:: Mus musculus

Reporter:: GPL340, 1459107_at (ID_REF), GDS2483, 16512 (Gene ID), BG069378

DataSet type:: Expression profiling by array, count, 36 samples

ID:: 33550379

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 234166793.

Kcnh3 - Lymphotoxin-beta receptor signaling inhibition effect on lymph nodes: time course (MG-430B)

Annotation:: Kcnh3, potassium voltage-gated channel, subfamily H (eag-related), member 3

Organism:: Mus musculus

Reporter:: GPL340, 1459107_at (ID_REF), GDS2005, 16512 (Gene ID), BG069378

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 23416679

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 75051034.

Kcnh3 - MPSS transcriptome analysis project

Annotation:: Kcnh3, potassium voltage-gated channel, subfamily H (eag-related), member 3

Organism:: Mus musculus

Reporter:: GPL1010, GATCCACAGGCTCTGCTCCA (ID_REF), GDS868, NM_010601

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7505103

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 521326025.

Kcnh3 - Brain response to human and chimpanzee diets

Annotation:: Kcnh3, potassium voltage-gated channel, subfamily H (eag-related), member 3

Organism:: Mus musculus

Reporter:: GPL1261, 1459107_at (ID_REF), GDS3232, 16512 (Gene ID), BG069378

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 52132602

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1079578026.

Kcnh3 - Streptozotocin effect on pancreas of offspring of protein-restricted dams

Annotation:: Kcnh3, potassium voltage-gated channel, subfamily H (eag-related), member 3

Organism:: Mus musculus

Reporter:: GPL1261, 1459107_at (ID_REF), GDS4949, 16512 (Gene ID), BG069378

DataSet type:: Expression profiling by array, transformed count, 11 samples

ID:: 107957802

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 683456027.

Kcnh3 - von Hippel-Lindau (VHL) tumor suppressor protein deficiency effect on pancreatic islet cells

Annotation:: Kcnh3, potassium voltage-gated channel, subfamily H (eag-related), member 3

Organism:: Mus musculus

Reporter:: GPL1261, 1459107_at (ID_REF), GDS3800, 16512 (Gene ID), BG069378

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 68345602

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 683323118.

Kcnh3 - von Hippel-Lindau (VHL) tumor suppressor protein deficiency effect on pancreatic islet cells

Annotation:: Kcnh3, potassium voltage-gated channel, subfamily H (eag-related), member 3

Organism:: Mus musculus

Reporter:: GPL1261, 1445805_x_at (ID_REF), GDS3800, 16512 (Gene ID), BG069378

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 68332311

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 223938799.

Kcnh3 - Retinoblastoma-like p107 knockout effect on neurospheres (MG-430B)

Annotation:: Kcnh3, potassium voltage-gated channel, subfamily H (eag-related), member 3

Organism:: Mus musculus

Reporter:: GPL340, 1459107_at (ID_REF), GDS1932, 16512 (Gene ID), BG069378

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 22393879

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 852527910.

Kcnh3 - Asthma and interleukin 13 (MOE430B)

Annotation:: Kcnh3, potassium voltage-gated channel, subfamily H (eag-related), member 3

Organism:: Mus musculus

Reporter:: GPL340, 1459107_at (ID_REF), GDS959, 16512 (Gene ID), BG069378

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 8525279

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4503770211.

Kcnh3 - Resting and activated natural killer cells

Annotation:: Kcnh3, potassium voltage-gated channel, subfamily H (eag-related), member 3

Organism:: Mus musculus

Reporter:: GPL1261, 1459107_at (ID_REF), GDS2957, 16512 (Gene ID), BG069378

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 45037702

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3754954212.

Kcnh3 - Embryonic J1 stem cell differentiation in vitro (MG-430B)

Annotation:: Kcnh3, potassium voltage-gated channel, subfamily H (eag-related), member 3

Organism:: Mus musculus

Reporter:: GPL340, 1445805_x_at (ID_REF), GDS2669, 16512 (Gene ID), BG069378

DataSet type:: Expression profiling by array, count, 33 samples

ID:: 37549542

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6045780213.

Kcnh3 - Norovirus infection effect on macrophage cell line

Annotation:: Kcnh3, potassium voltage-gated channel, subfamily H (eag-related), member 3

Organism:: Mus musculus

Reporter:: GPL1261, 1459107_at (ID_REF), GDS3549, 16512 (Gene ID), BG069378

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 60457802

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3354314214.

Kcnh3 - Ras-associated binding protein 3A mutations effect on brain cortices and hippocampi (MG-430B)

Annotation:: Kcnh3, potassium voltage-gated channel, subfamily H (eag-related), member 3

Organism:: Mus musculus

Reporter:: GPL340, 1445805_x_at (ID_REF), GDS2483, 16512 (Gene ID), BG069378

DataSet type:: Expression profiling by array, count, 36 samples

ID:: 33543142

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3755677915.

Kcnh3 - Embryonic J1 stem cell differentiation in vitro (MG-430B)

Annotation:: Kcnh3, potassium voltage-gated channel, subfamily H (eag-related), member 3

Organism:: Mus musculus

Reporter:: GPL340, 1459107_at (ID_REF), GDS2669, 16512 (Gene ID), BG069378

DataSet type:: Expression profiling by array, count, 33 samples

ID:: 37556779

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11233580216.

Kcnh3 - Cystatin B knockout model of progressive myoclonus epilepsy: cultured cerebellar granule cells

Annotation:: Kcnh3, potassium voltage-gated channel, subfamily H (eag-related), member 3

Organism:: Mus musculus

Reporter:: GPL1261, 1459107_at (ID_REF), GDS5091, 16512 (Gene ID), BG069378

DataSet type:: Expression profiling by array, transformed count, 7 samples

ID:: 112335802

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3751007917.

Kcnh3 - Embryonic R1 stem cell differentiation in vitro (MG-430B)

Annotation:: Kcnh3, potassium voltage-gated channel, subfamily H (eag-related), member 3

Organism:: Mus musculus

Reporter:: GPL340, 1459107_at (ID_REF), GDS2667, 16512 (Gene ID), BG069378

DataSet type:: Expression profiling by array, count, 33 samples

ID:: 37510079

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4208330218.

Kcnh3 - DNA electroporation effect on skeletal muscles: time course

Annotation:: Kcnh3, potassium voltage-gated channel, subfamily H (eag-related), member 3

Organism:: Mus musculus

Reporter:: GPL1261, 1459107_at (ID_REF), GDS2840, 16512 (Gene ID), BG069378

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 42083302

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4371697919.

Kcnh3 - Embryonic stem cells and embryoid bodies (MG-430B)

Annotation:: Kcnh3, potassium voltage-gated channel, subfamily H (eag-related), member 3

Organism:: Mus musculus

Reporter:: GPL340, 1459107_at (ID_REF), GDS2906, 16512 (Gene ID), BG069378

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 43716979

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2238664220.

Kcnh3 - Retinoblastoma-like p107 knockout effect on neurospheres (MG-430B)

Annotation:: Kcnh3, potassium voltage-gated channel, subfamily H (eag-related), member 3

Organism:: Mus musculus

Reporter:: GPL340, 1445805_x_at (ID_REF), GDS1932, 16512 (Gene ID), BG069378

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 22386642

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 16512) (1000)
GEO Profiles
SRA Links for BioSample (Select 40942350) (2)
SRA
Genome Links for Gene (Select 16512) (1)
Genome
Mus musculus
Mus musculus

Genome

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity