GEO Profile Links for Gene (Select 11752) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 2595

<< First< Prev

Page of 130

Next >Last >>

Select item 841285631.

Anxa8 - Host response to uninfected Ixodes scapularis nymphal tick attachment: time course

Annotation:: Anxa8, annexin A8

Organism:: Mus musculus

Reporter:: GPL8321, 1417732_at (ID_REF), GDS4357, 11752 (Gene ID), NM_013473

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 84128563

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 723152952.

Anxa8 - Oral mucosal adaptive immune model: time course

Annotation:: Anxa8, annexin A8

Organism:: Mus musculus

Reporter:: GPL1261, 1425789_s_at (ID_REF), GDS3909, 11752 (Gene ID), BC013271

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 72315295

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 569473953.

Anxa8 - Vancomycin effect on the kidney: dose response

Annotation:: Anxa8, annexin A8

Organism:: Mus musculus

Reporter:: GPL1261, 1425789_s_at (ID_REF), GDS3435, 11752 (Gene ID), BC013271

DataSet type:: Expression profiling by array, count, 48 samples

ID:: 56947395

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 548347954.

Anxa8 - Helicobacter pylori infection effect on a gastric epithelial progenitor cell line

Annotation:: Anxa8, annexin A8

Organism:: Mus musculus

Reporter:: GPL1261, 1425789_s_at (ID_REF), GDS3346, 11752 (Gene ID), BC013271

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 54834795

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 548267635.

Anxa8 - Helicobacter pylori infection effect on a gastric epithelial progenitor cell line

Annotation:: Anxa8, annexin A8

Organism:: Mus musculus

Reporter:: GPL1261, 1417732_at (ID_REF), GDS3346, 11752 (Gene ID), NM_013473

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 54826763

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 428756956.

Anxa8 - Folate deficiency and arsenic effect on the skin

Annotation:: Anxa8, annexin A8

Organism:: Mus musculus

Reporter:: GPL1261, 1425789_s_at (ID_REF), GDS2872, 11752 (Gene ID), BC013271

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 42875695

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 428676637.

Anxa8 - Folate deficiency and arsenic effect on the skin

Annotation:: Anxa8, annexin A8

Organism:: Mus musculus

Reporter:: GPL1261, 1417732_at (ID_REF), GDS2872, 11752 (Gene ID), NM_013473

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 42867663

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 415196958.

Anxa8 - Cannabinoid receptor double knockout mutant response to contact allergen

Annotation:: Anxa8, annexin A8

Organism:: Mus musculus

Reporter:: GPL1261, 1425789_s_at (ID_REF), GDS2820, 11752 (Gene ID), BC013271

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 41519695

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 415116639.

Anxa8 - Cannabinoid receptor double knockout mutant response to contact allergen

Annotation:: Anxa8, annexin A8

Organism:: Mus musculus

Reporter:: GPL1261, 1417732_at (ID_REF), GDS2820, 11752 (Gene ID), NM_013473

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 41511663

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3881858410.

Anxa8 - Pubertal mammary gland development

Annotation:: Anxa8, annexin A8

Organism:: Mus musculus

Reporter:: GPL339, 1425789_s_at (ID_REF), GDS2721, 11752 (Gene ID), BC013271

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 38818584

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3881066311.

Anxa8 - Pubertal mammary gland development

Annotation:: Anxa8, annexin A8

Organism:: Mus musculus

Reporter:: GPL339, 1417732_at (ID_REF), GDS2721, 11752 (Gene ID), NM_013473

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 38810663

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2149049112.

Anxa8 - Myotube response to PGC-1alpha induced mitochondrial biogenesis: time course (MG-U74A)

Annotation:: Anxa8, annexin A8

Organism:: Mus musculus

Reporter:: GPL81, 97529_at (ID_REF), GDS1878, 11752 (Gene ID), AJ002390

DataSet type:: Expression profiling by array, count, 21 samples

ID:: 21490491

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1608588413.

Anxa8 - Beta-catenin activation effect on skin: time course

Annotation:: Anxa8, annexin A8

Organism:: Mus musculus

Reporter:: GPL339, 1425789_s_at (ID_REF), GDS1560, 11752 (Gene ID), BC013271

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 16085884

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1607796314.

Anxa8 - Beta-catenin activation effect on skin: time course

Annotation:: Anxa8, annexin A8

Organism:: Mus musculus

Reporter:: GPL339, 1417732_at (ID_REF), GDS1560, 11752 (Gene ID), NM_013473

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 16077963

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1303720315.

Anxa8 - Testosterone effect on meibomian gland

Annotation:: Anxa8, annexin A8

Organism:: Mus musculus

Reporter:: GPL1310, 6703 (ID_REF), GDS1361, NM_013473

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 13037203

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 903740316.

Anxa8 - Male and female salivary gland comparison

Annotation:: Anxa8, annexin A8

Organism:: Mus musculus

Reporter:: GPL1310, 6703 (ID_REF), GDS1009, NM_013473

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 9037403

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 806549117.

Anxa8 - Hair follicle development: time course

Annotation:: Anxa8, annexin A8

Organism:: Mus musculus

Reporter:: GPL81, 97529_at (ID_REF), GDS912, 11752 (Gene ID), AJ002390

DataSet type:: Expression profiling by array, count, 25 samples

ID:: 8065491

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 752921918.

Anxa8 - MPSS transcriptome analysis project

Annotation:: Anxa8, annexin A8

Organism:: Mus musculus

Reporter:: GPL1010, GATCGTGGTCTCCGAGCCTG (ID_REF), GDS868, NM_013473

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7529219

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 733819119.

Anxa8 - Corneal stromal cell differentiation

Annotation:: Anxa8, annexin A8

Organism:: Mus musculus

Reporter:: GPL81, 97529_at (ID_REF), GDS857, 11752 (Gene ID), AJ002390

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 7338191

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 703079120.

Anxa8 - Hair follicle stem cell characterization

Annotation:: Anxa8, annexin A8

Organism:: Mus musculus

Reporter:: GPL81, 97529_at (ID_REF), GDS840, 11752 (Gene ID), AJ002390

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 7030791

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 130

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 11752) (2595)
GEO Profiles
Gene neighbors for Gene (Select 11752) (7)
Gene

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 2595

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity