GEO Profile Links for Gene (Select 21828) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 1065688881.

Thbs4 - Age effect on skeletal muscle precursor cells

Annotation:: Thbs4, thrombospondin 4

Organism:: Mus musculus

Reporter:: GPL1261, 1449388_at (ID_REF), GDS4892, 21828 (Gene ID), NM_011582

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 106568888

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 957324882.

Thbs4 - Cmah knockout effect on mdx model of Duchenne Muscular Dystrophy (DMD): skeletal muscle

Annotation:: Thbs4, thrombospondin 4

Organism:: Mus musculus

Reporter:: GPL1261, 1449388_at (ID_REF), GDS4200, 21828 (Gene ID), NM_011582

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 95732488

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 172291883.

Thbs4 - RPE65 null mutant model of Leber's congenital amaurosis

Annotation:: Thbs4, thrombospondin 4

Organism:: Mus musculus

Reporter:: GPL1261, 1449388_at (ID_REF), GDS1647, 21828 (Gene ID), NM_011582

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 17229188

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1291496674.

Thbs4 - Citrobacter rodentium infection of interleukin-10 deficient colon

Annotation:: Thbs4, thrombospondin 4

Organism:: Mus musculus

Reporter:: GPL7202, A_52_P401504 (ID_REF), GDS5629, NM_011582, A_52_P401504 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 129149667

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1320538465.

Thbs4 - Nebulin deficiency effect on the soleus

Annotation:: Thbs4, thrombospondin 4

Organism:: Mus musculus

Reporter:: GPL6246, 10411082 (ID_REF), GDS5881, NM_011582, AF102887, BC139414, chr13:92751586-92794758 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 132053846

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 766992886.

Thbs4 - Rosiglitazone effect on streptozotocin-induced diabetic DBA/2J mice: perpheral sciatic nerve

Annotation:: Thbs4, thrombospondin 4

Organism:: Mus musculus

Reporter:: GPL1261, 1449388_at (ID_REF), GDS4036, 21828 (Gene ID), NM_011582

DataSet type:: Expression profiling by array, count, 19 samples

ID:: 76699288

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 821920887.

Thbs4 - Laminin alpha2 chain deficiency effect on skeletal muscle

Annotation:: Thbs4, thrombospondin 4

Organism:: Mus musculus

Reporter:: GPL1261, 1449388_at (ID_REF), GDS3371, 21828 (Gene ID), NM_011582

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 82192088

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1255829468.

Thbs4 - MEK inhibitor PD-0325901 and rapamycin combined treatment effect on malignant peripheral nerve sheath tumor model

Annotation:: Thbs4, thrombospondin 4

Organism:: Mus musculus

Reporter:: GPL6246, 10411082 (ID_REF), GDS5419, NM_011582, AF102887, BC139414, chr13:92751586-92794758 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 125582946

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1140386469.

Thbs4 - Synergist ablation effect on young adult plantaris muscle: time course

Annotation:: Thbs4, thrombospondin 4

Organism:: Mus musculus

Reporter:: GPL6246, 10411082 (ID_REF), GDS4932, NM_011582, AF102887, BC139414, chr13:92751586-92794758 (SPOT ID)

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 114038646

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11856548810.

Thbs4 - Lamin A exon 9 deletion effect on fibroblasts

Annotation:: Thbs4, thrombospondin 4

Organism:: Mus musculus

Reporter:: GPL1261, 1449388_at (ID_REF), GDS5235, 21828 (Gene ID), NM_011582

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118565488

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2130050011.

Thbs4 - Chondrocyte differentiation: time course

Annotation:: Thbs4, thrombospondin 4

Organism:: Mus musculus

Reporter:: GPL339, 1449388_at (ID_REF), GDS1865, 21828 (Gene ID), NM_011582

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 21300500

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10921796812.

Thbs4 - Diabetic db/db heart response to rosiglitazone

Annotation:: Thbs4, thrombospondin 4

Organism:: Mus musculus

Reporter:: GPL4134, 8068 (ID_REF), GDS4990, NM_011582, A_51_P353221 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 15 samples

ID:: 109217968

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6504066213.

Thbs4 - Lean B6.C-D7Mit353 strain: various tissues

Annotation:: Thbs4, thrombospondin 4

Organism:: Mus musculus

Reporter:: GPL2995, 877390 (ID_REF), GDS3692, NM_011582

DataSet type:: Expression profiling by array, count, 25 samples

ID:: 65040662

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3423668814.

Thbs4 - Transcriptional coactivator PGC-1beta hypomorphic mutation effect on the skeletal muscle

Annotation:: Thbs4, thrombospondin 4

Organism:: Mus musculus

Reporter:: GPL1261, 1449388_at (ID_REF), GDS2515, 21828 (Gene ID), NM_011582

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 34236688

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11434070015.

Thbs4 - FG-3019/gemcitabine combined-treatment effect on KPC model of pancreatic ductal adenocarcinoma

Annotation:: Thbs4, thrombospondin 4

Organism:: Mus musculus

Reporter:: GPL8321, 1449388_at (ID_REF), GDS4945, 21828 (Gene ID), NM_011582

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 114340700

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5181976116.

Thbs4 - Interleukin-22 effect on colon cultures

Annotation:: Thbs4, thrombospondin 4

Organism:: Mus musculus

Reporter:: GPL2872, 31661 (ID_REF), GDS3226, NM_011582, A_51_P353221 (SPOT ID)

DataSet type:: Expression profiling by array, log10 ratio, 6 samples

ID:: 51819761

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 750831217.

Thbs4 - MPSS transcriptome analysis project

Annotation:: Thbs4, thrombospondin 4

Organism:: Mus musculus

Reporter:: GPL1010, GATCGACCCCAACTGGGTGG (ID_REF), GDS868, NM_011582

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7508312

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9857354618.

Thbs4 - Cardiac right ventricle hypertrophy model

Annotation:: Thbs4, thrombospondin 4

Organism:: Mus musculus

Reporter:: GPL6246, 10411082 (ID_REF), GDS4545, NM_011582, AF102887, BC139414, chr13:92751586-92794758 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 98573546

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4680533019.

Thbs4 - Dicer inactivation effect on the embryonic heart

Annotation:: Thbs4, thrombospondin 4

Organism:: Mus musculus

Reporter:: GPL5025, 7830 (ID_REF), GDS3033, NM_011582

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46805330

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9794140020.

Thbs4 - Melanoma models with contrasting metastatic potential

Annotation:: Thbs4, thrombospondin 4

Organism:: Mus musculus

Reporter:: GPL8321, 1449388_at (ID_REF), GDS4531, 21828 (Gene ID), NM_011582

DataSet type:: Expression profiling by array, transformed count, 16 samples

ID:: 97941400

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 21828) (1000)
GEO Profiles
Gene neighbors for Gene (Select 21828) (9)
Gene
Related DataSets for GEO Profiles (Select 130334403) (1)
GEO DataSets
Pulmonary dendritic cell subsets
Pulmonary dendritic cell subsets
Accession: GDS5663

GEO DataSets
RecName: Full=Complement C1q subcomponent subunit B; Flags: Precursor
RecName: Full=Complement C1q subcomponent subunit B; Flags: Precursor
gi|408359989|sp|P14106.2|C1QB_MOUSE

Protein

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity