GEO Profile Links for Gene (Select 227292) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 414325121.

Ctdsp1 - Nephronophthisis model

Annotation:: Ctdsp1, CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

Organism:: Mus musculus

Reporter:: GPL2897, 353088 (ID_REF), GDS2817, NM_153088, BB613893

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 41432512

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 261732182.

Ctdsp1 - Alpha-tropomyosin mutant models of familial cardiac hypertrophy

Annotation:: Ctdsp1, CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

Organism:: Mus musculus

Reporter:: GPL339, 1452055_at (ID_REF), GDS2134, 227292 (Gene ID), BB770944

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 26173218

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1070959503.

Ctdsp1 - Stearoyl-CoA desaturase-1 deficiency effect on the skin

Annotation:: Ctdsp1, CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1452055_at (ID_REF), GDS4910, 227292 (Gene ID), BB770944

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 107095950

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 188049124.

Ctdsp1 - MicroRNA miR-122 antisense inhibition effect on livers

Annotation:: Ctdsp1, CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

Organism:: Mus musculus

Reporter:: GPL2897, 353088 (ID_REF), GDS1729, NM_153088, BB613893

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 18804912

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 317247505.

Ctdsp1 - B cell-activating factor of the TNF family effect on B cells

Annotation:: Ctdsp1, CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1452055_at (ID_REF), GDS2408, 227292 (Gene ID), BB770944

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 31724750

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1129790506.

Ctdsp1 - Progesterone effect on uteri of ovariectomized, steroid receptor coregulator-2 deficient mutants

Annotation:: Ctdsp1, CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1452055_at (ID_REF), GDS4866, 227292 (Gene ID), BB770944

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 112979050

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1303716217.

Ctdsp1 - Estradiol effect on uterus of EAAE estrogen receptor α DNA-binding-deficient model

Annotation:: Ctdsp1, CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

Organism:: Mus musculus

Reporter:: GPL4134, 26621 (ID_REF), GDS5664, NM_153088, A_51_P222071 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 130371621

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 542964508.

Ctdsp1 - c-Myc transgenic model of lung adenocarcinomas

Annotation:: Ctdsp1, CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1452055_at (ID_REF), GDS3321, 227292 (Gene ID), BB770944

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 54296450

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 534366509.

Ctdsp1 - Fibroblast pseudopodia response to lysophosphatidic acid

Annotation:: Ctdsp1, CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1452055_at (ID_REF), GDS3287, 227292 (Gene ID), BB770944

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 53436650

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6433798510.

Ctdsp1 - Hypertension model: aorta

Annotation:: Ctdsp1, CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

Organism:: Mus musculus

Reporter:: GPL9734, 100105250_TGI_at (ID_REF), GDS3672, NM_153088

DataSet type:: Expression profiling by array, count, 23 samples

ID:: 64337985

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2643315011.

Ctdsp1 - Bone morphogenic protein receptor 2 inactivation in smooth muscle effect on the lung: time course

Annotation:: Ctdsp1, CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1452055_at (ID_REF), GDS2147, 227292 (Gene ID), BB770944

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 26433150

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4311135012.

Ctdsp1 - Inert particles effect on the lungs of pregnant females

Annotation:: Ctdsp1, CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1452055_at (ID_REF), GDS2878, 227292 (Gene ID), BB770944

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 43111350

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3630615013.

Ctdsp1 - Histone deacetylase-2 deficiency effect on the embryonic heart

Annotation:: Ctdsp1, CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1452055_at (ID_REF), GDS2624, 227292 (Gene ID), BB770944

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 36306150

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6105515014.

Ctdsp1 - Mutant transcription factor ThPOK effect on memory P14 T cells

Annotation:: Ctdsp1, CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1452055_at (ID_REF), GDS3566, 227292 (Gene ID), BB770944

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 61055150

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1189195015.

Ctdsp1 - Aldosterone effect on heart: time course

Annotation:: Ctdsp1, CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1452055_at (ID_REF), GDS1303, 227292 (Gene ID), BB770944

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 11891950

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13204708316.

Ctdsp1 - Nebulin deficiency effect on the soleus

Annotation:: Ctdsp1, CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

Organism:: Mus musculus

Reporter:: GPL6246, 10347351 (ID_REF), GDS5881, NM_153088, AY028804, BC049184, BC058085, BC065158, BC079638, chr1:74391599-74397285 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 132047083

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 2810705017.

Ctdsp1 - Flagellin effect on toll-like receptor 5 deficient intestinal lamina propria cells

Annotation:: Ctdsp1, CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1452055_at (ID_REF), GDS2212, 227292 (Gene ID), BB770944

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 28107050

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4331775018.

Ctdsp1 - X-linked Emery-Dreifuss muscular dystrophy model and cardiomyopathy

Annotation:: Ctdsp1, CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1452055_at (ID_REF), GDS2884, 227292 (Gene ID), BB770944

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 43317750

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7662335019.

Ctdsp1 - Time course of diabetes-induced, anti-Interferon-γ injected NOD.Scid mice: pancreatic islets

Annotation:: Ctdsp1, CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

Organism:: Mus musculus

Reporter:: GPL1261, 1452055_at (ID_REF), GDS4034, 227292 (Gene ID), BB770944

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 76623350

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 748715420.

Ctdsp1 - MPSS transcriptome analysis project

Annotation:: Ctdsp1, CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 1

Organism:: Mus musculus

Reporter:: GPL1010, GATCTAGGCTGACCTGAGAG (ID_REF), GDS868, BC049184

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7487154

GEO DataSets Gene Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 227292) (1000)
GEO Profiles
Genome Links for Gene (Select 227292) (1)
Genome
Mus musculus
Mus musculus

Genome

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity