GEO Profile Links for Gene (Select 19328) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1000

<< First< Prev

Page of 50

Next >Last >>

Select item 91909361.

Rab12 - Skeletal muscle response to voluntary running: time course

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL254, 13208 (ID_REF), GDS1019, AK013690

DataSet type:: Expression profiling by array, log ratio, 7 samples

ID:: 9190936

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 32391932.

Rab12 - Malaria resistance

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL519, 13693 (ID_REF), GDS471, AW555450

DataSet type:: Expression profiling by array, log ratio, 14 samples

ID:: 3239193

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 360140873.

Rab12 - Caloric restriction effect on aged skeletal muscle

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL339, 1427992_a_at (ID_REF), GDS2612, 19328 (Gene ID), BF729629

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 36014087

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 208813984.

Rab12 - Skeletal muscle synaptic region

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL1261, 1427992_a_at (ID_REF), GDS1838, 19328 (Gene ID), BF729629

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 20881398

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 63298715.

Rab12 - Typical and atypical antipsychotic drugs effect on brain

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL891, 7271 (ID_REF), GDS775, NM_024448, A_51_P318012 (SPOT ID)

DataSet type:: Expression profiling by array, log ratio, 4 samples

ID:: 6329871

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 728345116.

Rab12 - Spatial and temporal development of mammalian salivary glands

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P458230 (ID_REF), GDS3922, AK054427, A_51_P458230 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 84 samples

ID:: 72834511

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 342152987.

Rab12 - Transcriptional coactivator PGC-1beta hypomorphic mutation effect on the skeletal muscle

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL1261, 1427992_a_at (ID_REF), GDS2515, 19328 (Gene ID), BF729629

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 34215298

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 643925298.

Rab12 - Hypertension model: heart

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL9734, 100084468_TGI_at (ID_REF), GDS3673, NM_024448

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 64392529

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 261652879.

Rab12 - Alpha-tropomyosin mutant models of familial cardiac hypertrophy

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL339, 1427992_a_at (ID_REF), GDS2134, 19328 (Gene ID), BF729629

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 26165287

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 566388310.

Rab12 - Extraocular, limb, and masticatory muscle comparison

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL32, 104082_at (ID_REF), GDS702, 19328 (Gene ID), AI848325

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 5663883

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6194627811.

Rab12 - p300 genetic reduction model of Rubinstein-Taybi syndrome: hippocampus

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL1261, 1457783_at (ID_REF), GDS3598, 19328 (Gene ID), BM210713

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 61946278

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13202159712.

Rab12 - Nebulin deficiency effect on the quadriceps

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL6246, 10452556 (ID_REF), GDS5880, NM_024448, XM_006523889, AB232607, BC027647, chr17:66494512-66519670 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 132021597

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10643059713.

Rab12 - Histone deacetylase 3 deficiency effect on the heart

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL6246, 10452556 (ID_REF), GDS4886, NM_024448, XM_006523889, AB232607, BC027647, chr17:66494512-66519670 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 106430597

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8904297814.

Rab12 - Nitric oxide generator DETA-NONOate effect on in vitro neuronal injury model: time course

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL1261, 1457783_at (ID_REF), GDS4408, 19328 (Gene ID), BM210713

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 89042978

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4517201615.

Rab12 - Male and female thymi response to aging and caloric restriction (B)

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL782, 13764 (ID_REF), GDS2962, AW555450

DataSet type:: Expression profiling by array, transformed count, 67 samples

ID:: 45172016

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 13205829716.

Rab12 - Nebulin deficiency effect on the soleus

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL6246, 10452556 (ID_REF), GDS5881, NM_024448, XM_006523889, AB232607, BC027647, chr17:66494512-66519670 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 132058297

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 567698317.

Rab12 - Dystrophin-deficient mdx extraocular and leg muscle

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL32, 104082_at (ID_REF), GDS703, 19328 (Gene ID), AI848325

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 5676983

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3896379818.

Rab12 - Estrogen-related receptor alpha deficiency effect on the heart

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL1261, 1427992_a_at (ID_REF), GDS2727, 19328 (Gene ID), BF729629

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 38963798

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10659319719.

Rab12 - Heart response to isocitrate dehydrogenase 2 mutations IDH2R140Q and IDH2R172K

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL6246, 10452556 (ID_REF), GDS4893, NM_024448, XM_006523889, AB232607, BC027647, chr17:66494512-66519670 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 106593197

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 753173720.

Rab12 - MPSS transcriptome analysis project

Annotation:: Rab12, RAB12, member RAS oncogene family

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCACCAGAGCTGCCTC (ID_REF), GDS868, AK013690

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7531737

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 50

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 19328) (1000)
GEO Profiles
Mus musculus
Mus musculus

Genome
Genome Links for Protein (Select 1907131888) (1)
Genome
OMIM Links for GEO Profiles (Select 103814309) (1)
OMIM
ZPBP2 zona pellucida binding protein 2 [Homo sapiens]
ZPBP2 zona pellucida binding protein 2 [Homo sapiens]
Gene ID:124626

Gene

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1000

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity