GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Platform GPL6480

Query DataSets for GPL6480

Status

Public on Feb 11, 2008

Title

Agilent-014850 Whole Human Genome Microarray 4x44K G4112F (Probe Name version)

Technology type

in situ oligonucleotide

Distribution

commercial

Organism

Homo sapiens

Manufacturer

Agilent Technologies

Manufacture protocol

see manufacturer's web site at http://www.agilent.com/

Catalog number

G4112F

Description

This multi-pack (4X44K) formatted microarray represents a compiled view of the human genome as it is understood today. The sequence information used to design this product was derived from a broad survey of well known sources such as RefSeq, Goldenpath, Ensembl, Unigene and others. The resulting view of the human genome covers 41K unique genes and transcripts which have been verified and optimized by alignment to the human genome assembly and by Agilent's Empirical Validation process.

*** The ID column includes the Agilent Probe Names. A different version of this platform with the Agilent Feature Extraction feature numbers in the ID column is assigned accession number GPL4133

Submission date

Feb 11, 2008

Last update date

Jan 23, 2019

Organization

Agilent Technologies

E-mail(s)

cag_sales-na@agilent.com

Phone

877-424-4536

URL

http://www.agilent.com

Department

Street address

City

Palo Alto

State/province

ZIP/Postal code

94304

Country

USA

Samples (24853)

More...

GSM264878, GSM264879, GSM264880, GSM264881, GSM264882, GSM264883

Series (943)

More...

GSE10469	Time course progression of BMP4-treated hESC gene expressions under 4 % and 20 % oxygen conditions.
GSE10878	Integrative Genome-wide Analysis of Glioblastoma.
GSE12435	IMR90 4hr bystander experiment 0.5Gy alpha particle strip dish format

GSE12493	A TGFB Responsive Gene Expression Signature is Associated With More Severe Skin and Lung Disease in Diffuse Scleroderma
GSE12531	Global gene expression analysis of undifferentiated H1 hESC, and hEB cells differentiated with SF BVF2H conditions
GSE12664	Analysis of wild-type and C mutant human HPIV1 and interferon beta treatment in human respiratory epithelial A549 cells
GSE12665	Gene expression profiling of invasive breast cancer events from the tamoxifen prevention trial
GSE13213	Relapse-related molecular signature in lung adenocarcinomas identifies patients with dismal prognosis
GSE13357	Human ES cells' gene expression difference compared with that of the adult cells including CCD-1079sk and IMR90
GSE13462	Comparison of human ES cells, mouse ES cells, rat iPS cells and their somatic cells.
GSE13571	human MRC-5 cells' gene expression difference compared with that of the adult cells including CCD-1079sk and IMR90
GSE13600	Use of spermatozoal total RNA profiles to study gene-environment interactions in human germ cells
GSE13893	Dynamic response of annexin A11-associated gene expression to cisplatin treatment
GSE14232	Transcriptome analysis of freshly sorted and expanded regulatory and conventional T cells
GSE14273	The target genes of transcript factor ZNF191
GSE14281	Regulatory and conventional T-cells
GSE14284	Molecular signatures of N-nitroso compounds in Caco-2 cells: implications for colon carcinogenesis
GSE14422	Histone methylations and gene expression in naïve, central (TCM) and effector (TEM) memory CD8 T cells.
GSE14445	Melanoma SK-Mel-103 cell line : control vs. treated with pIC/pIC+PEI
GSE14487	A gene expression signature classifying telomerase and ALT immortalization I
GSE14529	A gene expression signature classifying telomerase and ALT immortalization II
GSE14532	GSK3 activates telomerase by regulating dynamic behaviour of multiple transcription factors converging on the hTERT gene
GSE14533	A gene expression signature classifying telomerase and ALT immortalization
GSE14838	Gene expression changes by 2,4-dinitrochlorobenzene in human bulge-derived keratinocytes
GSE14922	Human Adrenocortical Tumors: normal cortex vs inactive adenoma vs cortisol secreting adenoma vs adrenocortical cancer
GSE15170	Expression profiling of nasopharyngeal carcinoma cell lines
GSE15191	Nasopharyngeal carcinoma cell lines TW01 and HONE1: transcriptomic and genomic analyses
GSE15197	RNA Expression Profiling of Lung Tissue Identifies Mutually Distinct Molecular Signatures in PAH and PH Secondary to IPF
GSE15259	Effects of far-infrared rays on normal prostate epithelial cells (PrEC)
GSE15266	Effects of far-infrared rays on prostate cancer cells and normal prostate epithelial cells
GSE15327	Global Gene Expression Analysis Reveals Differences in Cellular Responses to Hydroxyl- and Superoxide Anion Radical-...
GSE15366	Chronic Hypoxia predicts Poor Prognosis in Hepatocellular Carcinoma
GSE16004	Rearrangement of actin stress fiber in HUVECs under cyclic stretch
GSE16076	Transcriptome analysis of myelid cell types (normal and leukemic)
GSE16077	Effects of far-infrared rays to human prostate cancer cell line PC-3
GSE16239	Genes regulated by miR-181c
GSE16255	Gene expression in a Highly Tumorigenic Cells (HTC) purified from Urothelial Cancer
GSE16337	Foreskin Melanocyte: control vs. treated with pIC/pIC+PEI
GSE16425	Gene expression profiles in human keratinocytes exposure to ultrafine, fine, and submicron TiO2 particles
GSE16441	Identifying mRNA targets of microRNA in clear cell renal cell carcinoma
GSE16449	Molecular Stratification of Clear Cell Renal Cell Carcinoma Reveals Distinct Subtypes and Survival Patterns
GSE16627	Functional genomics of human bronchial epithelial cells directly interacting with conidiospores of Aspergillus fumigatus
GSE16628	Functional genomics of human bronchial epithelial cells interacting with conidiospores of Aspergillus fumigatus
GSE16637	Transcriptomic analysis of interactions between Aspergillus fumigatus conidiospores and human bronchial epithelial cells
GSE16643	Effect of glucocorticoid chemical structure and receptor potency on human trabecular meshwork cells
GSE16706	Endothelial Responses to Atheroprone Flow
GSE16763	Gene expression profiles of LEC, MLC-L, and MSC-BM
GSE16858	Human NTERA2 (NT2/D1) cells lines: shZRF1 vs. shRandom during Retinoic Acid (RA) administration
GSE16890	NCI-H1299 cell line transfected with human DENND2D and vector
GSE16891	Human NTERA2 (NT2/D1) cells lines
GSE16935	Response of the EPI-200 human 3-D skin model to high and low doses of protons
GSE16991	Gene expression profiling of retinoblastoma Y79 cell line post EpCAM silencing using siRNA
GSE16998	Gene expression profiling of retinoblastoma Y79 cell line treated with scopoletin from Morinda citrifolia in vitro
GSE16999	Gene expression analysis study in cerulenin treated and control Y79 cells
GSE17034	Gene expression analysis study in curcumin treated and control Y79 cells
GSE17068	Inducing and Predicting Immune Tolerance After Kidney Transplantation
GSE17118	TCEAL7 Inhibition of c-Myc Activity in Alternative Lengthening of Telomeres Regulates hTERT Expression
GSE17188	Hypoxia response by human breast cancer cell MDA-MB-231 sublines
GSE17260	Prediction of progression-free survival in patients with advanced-stage serous ovarian cancer
GSE17261	Regulatory Macrophages
GSE17399	Homeobox gene IRX1 is a tumor suppressor gene in gastric carcinoma
GSE17493	Molecular and functional characterization of alloantigen-specific anergic T-cell suitable for cell therapy
GSE17676	Differential Effects of TiO2 Nanotubes on Vascular Cells
GSE17856	Gene expression in nontumoral liver tissue and recurrence-free survival in hepatitis C virus-positive HCC
GSE18054	Gene Expression Profiles of a Progression Model of Human Ovarian Cancer
GSE18058	Wilms Tumor cells with WT1 mutations have characteristic features of mesenchymal stem cells
GSE18378	Gene profiling and prediction of response to anastrozole neoadjuvant treatment in breast cancer
GSE18510	miR-193b represses cell proliferation and regulates cyclin D1 in melanoma: Malme-3M
GSE18512	miR-193b represses cell proliferation and regulates cyclin D1 in melanoma
GSE18553	Transcriptional analysis of an E2F gene signature as a biomarker of activity of the cyclin-dependent kinase inhibitor PHA-793887 in tumor and skin biopsies from a phase I clinical study
GSE18606	Transcript abundance patterns in Kawasaki disease patients IVIG-resistance
GSE18760	IMR90 bystander experiment 0.5 Gy alpha particle
GSE18967	Novel IL-21 signaling pathway upregulates c-Myc and induces apoptosis of diffuse large B-cell lymphomas
GSE19052	Identification of genes differentially regulated upon infection of Thp-1 cells with H37Rv
GSE19078	Transcriptomic profile indicative of immunotoxic exposure; in vitro studies in peripheral blood mononuclear cells
GSE19232	miR-335 orchestrates cell proliferation, migration and differentiation in human mesenchymal stem cells
GSE19236	Expression analysis of dendritic cells, macrophages and monocytes
GSE19422	Gene expression profiling of pheochromocytoma (PCC)/paraganglioma (PGL) tumors
GSE19536	Molecular Characterization of Breast Cancer Subtypes Derived from Joint Analysis of High Throughput miRNA and mRNA Data
GSE19612	A Hierarchy of Self-Renewing Tumor-Initiating Cell Types in Glioblastoma
GSE19617	Limited systemic sclerosis patients with PAH show biomarkers of inflammation and vascular injury
GSE19642	Expression profiling of HeLa Tet-off cells expressing Flag-tagged version of WT NIPP1 or PP1 binding mutant of NIPP1.
GSE19704	LNCaP prostate cancer cell line spheres (S) vs. adherent (A)
GSE19724	Gene expression profiling of Golabi-Ito-Hall derived lymphoblast cells compared to a matched healthy person
GSE19783	Molecular Characterization of Breast Cancer Subtypes from Joint Analysis of High Throughput miRNA and mRNA Data (II)
GSE19835	cryopreserved CD34 positive human umbilical cord blood cells
GSE19919	Gene expression data from Guthrie blood-spot cards
GSE20013	Transcriptional Characterization of Human Embryonic Stem Cell-Derived Endothelial Cells
GSE20014	Minicircle-derived iPS cells - Agilent Data
GSE20088	Profiling of genes deregulated in CD4+ T cells expressing constitutively full-length or first-exon Tat protein of HIV-1
GSE20162	Prediction of in vivo radiation dose in radiotherapy patients using ex vivo and in vivo gene expression signatures
GSE20170	Gene expression profie of OSMF (Oral Submucous Fibrosis) tissues compared with the expression in normal oral tissues
GSE20173	Gene expression profiling of PBL in response to ionising radiation and modeled microgravity
GSE20277	Translatome and transcriptome profiling of EGF response in HeLa cells
GSE20463	Homo sapiens MSCs: Normoxia vs. Hypoxia
GSE20563	Knockdown of PHF8 in HeLa S3 cells
GSE20629	Global gene expression responses to low doses of protons in a human 3-dimensional skin model
GSE20668	Gene expression in human umbilical cord endothelial cells following premiR-100 overexpression
GSE20706	Interleukin-4 and interleukin-13 cytokines effect on epidermal keratinocytes
GSE20722	Influence of alkyl-phospholipids on the gene expression profile of immortalized keratinocytes HaCaT
GSE20753	PHF8 targets histone methylation and RNA polymerase II to activate transcription
GSE20755	Identification and analysis of miRNA target genes in a cell system
GSE20914	Expression of HCT116 cells transfected with CD44 siRNAs relative to that of HCT116 cells transfected with a control siRNA
GSE20945	Effects of DAC treatment
GSE20951	Effects of Ionizing Radiation on Self Renewal and Pluripotency of Human Embryonic Stem Cells
GSE21059	IMR90 radiation bystander time-course experiment 0.5Gy alpha particle
GSE21240	Effect of blood sample storage on the study of gene expression in response to ionizing radiation exposure
GSE21429	Regulation of human skin pigmentation in situ by repetitive UV exposure - Molecular characterization of responses to UVA, UVB and SSR
GSE21518	Caco-2 cells: 21-days differentiated cells maintained with the low density protocol (LD cells) vs 21-days differentiated cells maintained with the high density protocol (HD cells)
GSE21561	Gene expression analysis of CBFbeta knockdown PPC1 cells
GSE21566	Radial Migration Assay and Analysis
GSE21730	Gene expression profiling of the Se-Ax cell line following E2A reconstitution
GSE21731	Genomic loss of the putative tumor suppressor gene E2A promotes cutaneous T-cell lymphoma in human
GSE21815	Gene expression profiles in 132 laser microdissected colorectal cancer tissues
GSE21974	Molecular Subtype Predicts Response to Neoadjuvant Chemotherapy in Breast Cancer
GSE22012	Translatome and transcriptome profiling of estradiol response in MCF7 cells
GSE22072	Toxin-antitoxin of Rickettsia determines fatal addiction of the host cells
GSE22088	Gene expression profiles of TiPS, HDF-iPS, ES and T cells
GSE22169	Comparison of CD44+/CD24- sorted fraction with 'rest' fraction of NBLE cells and primary breast cancer-derived cells
GSE22460	Combined miRNA and mRNA analysis of CD133(+) and CD34(+) cells
GSE22491	Transcriptomic profiling of peripheral blood mononuclear cells from patients with Parkinson’s disease and control subjects.
GSE22654	Myc-regulated gene expression in human fibroblasts
GSE22785	Integrated genome, transcriptome and translatome profiling of neuroblastoma cells
GSE22804	Gene expression profiling of gastric cancer
GSE22811	Genes regulated by PCK Inhibitors, enzastaurin and Go, in CAL-27 cells, a SCCHN cell line
GSE22820	Gene expression breast cancer
GSE22964	Gene expression patterns of EBV negative BJAB B-lymphoma lines stably and conditionally expressing EBNA-1
GSE23026	Combinatorial effects of microRNA to suppress the myc oncogenic pathway
GSE23091	Different propensity in hematopoietic differentiation potential among distinct human pluripotent stem cell lines
GSE23197	The ETS transcription factor ESE3 controls prostate epithelial cell differentiation
GSE23323	Transcriptomics in response to cigarette smoking in humans
GSE23387	Nickel Chloride (NiCl2) effect on human T cells from whole blood
GSE23393	In vivo gene expression changes in human blood cells in response to radiation therapy.
GSE23515	Radiation responses in peripheral white blood cells of smokers and non-smokers
GSE23558	Gene Expression Profiling of Oral Squamous Cell Carcinoma
GSE23589	Genes regulated by SOX2 overexpression in gastric cancer cells
GSE23611	Lung biopsies from asthmatics pre- and post- steroid treatment and from healthy control
GSE23697	Gene expression profiling in skeletal muscle 3 hours following the performance of an eccentric exercise
GSE23766	Transcriptional Profiling of Human Liver Identifies Sex-Biased Genes Associated with Polygenic Dyslipidemia and Coronary Artery Disease
GSE23805	Gene expression profile of human melanocytes derived from iPS cells
GSE23899	Bystander response to 0.5 Gy of alpha-particles in a human 3-dimensional skin model in 16h after exposure to ionizing radiation
GSE23910	AIRE hypoexpression and transcriptome profiles correlate with thymic impairment in Down syndrome
GSE23919	Whole genome gene expression modifications associated with micronucleus formation in blood cells from nitrosamine-exposed humans
GSE23924	cGvHD vs. non-cGvHD gene expression profiling in peripheral blood
GSE23930	MKK2 is sufficient but not necessary for proliferation and anchorage-independent growth of SK-MEL-28 cells.
GSE23933	human duodenum biopsy data
GSE23934	Crosstalk between B lymphocytes, microbiota and the intestinal epithelium governs immunity versus metabolism in the gut
GSE24065	Crossroads of the p53, ER, NFkB stress response networks
GSE24215	Insulin resistance induced by physical inactivity is associated with multiple transcriptional changes in skeletal muscle in young men
GSE24232	Human glioma cells treated with irradiation and/or CCI-779
GSE24247	Orientsia tsutsugamushi stimulates an original gene expression program in human monocytes: relationship with gene expression in patients with scrub typhus
GSE24287	Differential early pathogenic changes in human ileal gene expression in Crohn's disease and ulcerative colitis
GSE24381	Inhibition of BCL6-dependent gene expression in Philadelphia chromosome positive acute lymphoblastic leukemia
GSE24403	IL13 and CCL2 drive disease in an inflammatory subset of Scleroderma [IL13]
GSE24409	IL13 and CCL2 drive disease in an inflammatory subset of Scleroderma [IL4]
GSE24410	IL13 and CCL2 Drive Disease in an Inflammatory Subset of Scleroderma
GSE24426	BCL6 enables leukemia cells to cope with inhibition of oncogenic tyrosine kinases
GSE24453	Gene expression profiling of retinoblastoma Y79 cell line grown with scaffold compared to cells without scaffold
GSE24536	Molecular signature of CD8+ T cell exhaustion in metastases but not in peripheral blood from melanoma patients
GSE24579	Potentiation of glucocorticoid signaling by chloroquine via inhibition of lysosomes
GSE24677	DNA Methylation Dynamics in Human Induced Pluripotent Stem Cells over Time (Agilent)
GSE24818	Molecular markers of predictive value associated with low birth weight
GSE24891	Transcriptomic fingerprints in human peripheral blood mononuclear cells indicative of genotoxic and non-genotoxic carcinogenic exposure
GSE24945	Human skin fibroblast mitochondrial depletion, 0.5 Gy alpha-particle
GSE24980	MicroRNA-145 Regulates Human Corneal Epithelial Differentiation [Agilent-014850 array data]
GSE24981	MicroRNA-145 Regulates Human Corneal Epithelial Differentiation
GSE25215	Identification of target genes of miR-193b
GSE25220	Transcription levels in human colon biopsies in IBS and IBD patients before and after participating in a high red-meat dietary intervention
GSE25297	Genome-wide gene expression comparison (primary central nervous system lymphoma (PCNSL) vs normal lymph node)
GSE25299	Genomic profiling combined with gene expression profiling in primary central nervous system lymphoma
GSE25317	OVCAR-3 Cells: Control vs. FBA-TPQ treated
GSE25531	Alteration of peripheral blood monocyte gene expression in humans following diesel exhaust inhalation
GSE25683	genes deregulated by LMP2A in nasopharyngeal cancer
GSE25696	LMP2A promotes aggressive nasopharyngeal carcinoma tumor growth
GSE25699	Dose-dependent immunomodulation of human dendritic cells by the probiotic Lactobacillus rhamnosus Lcr35
GSE25981	Identification of genes upregulated by methyl-CpG targeted transcriptional activation (MeTA) in 293T
GSE25991	PEGylation of ORMOSIL nanoparticles differently modulates the in vitro toxicity toward human lung cells
GSE26082	Prototypes for 4x44K PAM50 Subtyping
GSE26215	Identification of genes upregulated by MeTA-array in human pancreatic cancers
GSE26237	Effects of ionomycin (final concentration of 2 µM) and BAPTA/AM (final concentration of 6 µM) on the RO82 W-1 human thyroid cell line
GSE26238	Human Breast Cells: Control vs. TRIM29 cDNA- or TRIM29 shRNA-transfected
GSE26415	Autism-associated gene expression signatures in peripheral blood leucocytes
GSE26417	Microarray analysis of CaSki cell line grown as spheroids and adherent conditions
GSE26419	Notch signaling in CD66+ cells drives the progression of human cervical cancers
GSE26428	Effect of Glis1 on human iPS cell generation
GSE26431	iPS cell generation
GSE26537	Heparins treated human breast cancer MCF-7 cell
GSE26634	Expression changes following siRNA knockdown of ADRM1 in ovarian cell line OAW42
GSE26662	miR-148b modulates the expression of multiple genes
GSE26666	miR148b is a major coordinator of breast cancer progression in a relapse-associated microRNA signature by targeting ITGA5, ROCK1, PIK3CA, NRAS and CSF1
GSE26774	siRNA knockdown of ribosomal protein gene RPL19 abrogates the aggressive phenotype of human prostate cancer
GSE26805	Expression of p16 and Retinoblastoma Determines Response to CDK 4/6 Inhibition in Ovarian Cancer: Ovarian cancer cell line expression data.
GSE26858	SMAD3 targets in A549 lung epithelial cells
GSE26917	Influence of cell cycle on responses of MCF-7 cells to benzo[a]pyrene
GSE26934	Post-epidemic eosinophilia myalgia syndrome associated with L-Tryptophan
GSE27283	Human ependymoma samples [expression]
GSE27287	Delineation of Two Clinically and Molecularly Distinct Subgroups of Posterior Fossa Ependymoma.
GSE27555	Preactivation of the interferon signaling in liver is correlated with non-response to interferon alpha therapy in patients chronically infected with hepatitis B virus
GSE27688	Gene expression and epigenetic profiling of CD34+ hematopoietic progenitor cells in multiple sclerosis patients (expression)
GSE27694	Gene expression and epigenetic profiling of CD34+ hematopoietic progenitor cells in multiple sclerosis patients
GSE27723	Mechanistic Rationale for Inhibition of Poly(ADP-Ribose) Polymerase in ETS Gene Fusion Positive Prostate Cancer
GSE27876	in vivo and in vitro study of asthma
GSE27882	Development of gene expression signatures for latent and clinical tuberculosis (TB)
GSE28009	Aldosterone-inducible genes in mineralocorticoid receptor expressed human endothelial cell lines
GSE28029	MicroRNAs Associated with Metastatic Prostate Cancer
GSE28042	Peripheral Blood Mononuclear Cell Gene Expression Profiles May Predict Poor Outcome in Idiopathic Pulmonary Fibrosis [Agilent]
GSE28076	The addition of chromosome 8 leads to characteristic dysregulation of gene expression on all chromosome and transformed-associated phenotypes
GSE28121	Discovery of Gene Expression Signature in the Overexpression of miR-145 in U87 glioma cell.
GSE28155	Loss of histone demethylase KDM6B enhances aggressiveness of pancreatic cancer through downregulation of C/EBPα
GSE28166	Host Regulatory Network Response to Infection with Highly Pathogenic H5N1 Avian Influenza Virus
GSE28204	mRNA expression profile in PCa And BPH from Chinese patients
GSE28221	Peripheral Blood Mononuclear Cell Gene Expression Profiles May Predict Poor Outcome in Idiopathic Pulmonary Fibrosis
GSE28245	Human medulloblastoma samples
GSE28484	Microarray analysis of chimeric CD4+CD28null and CD4+CD28+ T-cells in humanized mice.
GSE28569	Downregulation of CK2-Beta is sufficient to drive epithelial-to-mesenchymal transition through Snail 1 induction
GSE28584	Investigation of griffithsin's interactions with human cells confirms its outstanding safety and efficacy profile as a microbicide candidate
GSE28674	Hippocampal CA3 Transcriptome Signature and Dentate Gyrus MRI Features Correlate with Initial Precipitating Injury in Refractory Temporal Lobe Epilepsy
GSE28787	Interaction between endothelium and chronic lymphocytic leukemia B-cells rescues from apoptosis and modulates gene expression profile of leukemic cells
GSE28860	WU-BC 3, 4, and 5 PAM50 Subtypes with Passage and Gene Expression Comparison Between Xenografts and Primary Tumors
GSE28899	Identification of GLI1 direct target genes in human prostate cancer cell line PC3
GSE28900	Identification of GLI1 direct and indirect target genes in human prostate cancer cell line PC3
GSE28901	Identification of GLI1 direct target genes in human pancreatic cancer cell line Panc-1
GSE28902	Identification of GLI1 direct and indirect target genes in human pancreatic cancer cell line Panc-1
GSE29161	Gene Expression Analysis of Blood Reveals S100A11 and AQP9 as Potential Biomarkers of Infective Endocarditis
GSE29210	Prediction of Breast Cancer Estrogen Receptor Status using Machine Learning
GSE29229	Identification of the tumor suppressor gene at chromosome 5q21
GSE29391	Genome-wide gene expression profiling analysis of bone metastases of human non-small cell lung cancer (NSCLC) in mice
GSE29442	BRC77 Agilent Gene Expression Arrays
GSE29492	Combinatorial effects of microRNA to suppress the myc oncogenic pathway (mRNA data)
GSE29668	A2780 and OVCAR-3 Cells:Control vs. LS-98 treated
GSE29678	Expression profiling of human peripheral blood before and after omega 3 dietary supplement.
GSE29745	Human amnion and chondrosarcoma
GSE29870	Cancer-related epigenome changes associated with reprogramming to induced pluripotent stem cells (expression data)
GSE29873	Cancer-related epigenome changes associated with reprogramming to induced pluripotent stem cells
GSE29890	Development of a xenograft model for clinical oligo- and poly-metastatic progression
GSE29952	AEG-1 silencing induced gene expression alteration in glioma cells
GSE30133	Deep subcutaneous adipose tissue (dSAT) vs. superficial subcutaneous adipose (sSAT)
GSE30330	Coxiella burnetii infects JEG trophoblastic cell line, a model of placenta infection
GSE30351	Gene expression analysis of the antiviral effect of chloroquine and derivatives on in vitro HCV infected cells.
GSE30480	Gene expression profile of purified tumor cells from primary breast cancer tumor tissues and metastatic lymph nodes
GSE30530	MYCN-MB with MYCN amplification
GSE30658	Gene expression profile in the diaphragm following contractile inactivity during thoracic surgery
GSE30677	Lamin A/C is required for SHSY5Y neuroblastoma cell differentiation and its expression is linked to a less malignant phenotype.
GSE30815	CDK8 knockdown in HT-29 human colon cancer cells
GSE30817	CDK8 knockdown in HT-29 cells and CDK8 & MED12 knockdown in R1 cells
GSE30821	Integration of BRCA1-mediated miRNA and mRNA signatures reveal miR-146a, miR-99b and miR-205 regulation of the TRAF2 and NFkB pathways (mRNA dataset)
GSE30822	Integration of BRCA1-mediated miRNA and mRNA signatures reveal miR-146a, miR-99b and miR-205 regulation of the TRAF2 and NFkB pathways
GSE30886	A Common Peripheral Blood Gene-Set for Diagnosis and Prediction of Operational Tolerance in Pediatric and Adult Liver Transplantation
GSE30984	Genes downstream of p53 mediating its effect on megakaryopoiesis
GSE31079	Chronic hypoxia in patients with colon carcinoma
GSE31153	Mesenchymal Stem Cells Promote the Sustained Expression of CD69 on Activated T-lymphocytes: Roles of Canonical and Non-Canonical NF-κB Signaling
GSE31205	A small molecule modulator of prion protein enhances proliferation and engraftment of mesenchymal stem cells and extends their lifespan upon serial passage in culture
GSE31209	Altered CD45 isoform combination in C77G carriers influences the function of CD4+CD25high FoxP3+ regulatory T cells
GSE31433	Gene expression change in Skov3 after EZH2 knockdown
GSE31467	Gene expression profile of human epidermoid carcinoma KB cells that overexpress thymidine phosphorylase
GSE31515	Transcriptome analysis of endometriotic stromal cells treated with hydrogen peroxide
GSE31566	Pre-miR-375_A549 vs. Pre-miR-NC#2 (Ambion) _A549
GSE31603	Human breast cancer cell lines: vehicle vs. BMP4 incubation
GSE31604	Human breast cancer cell lines: vehicle vs. BMP7 incubation
GSE31605	Human breast cancer cell lines
GSE31612	Identification of SOX4 novel transcriptional targets.
GSE31697	Gene expression profiles of Calu-3 lung epithelial cells after neutrophil transmigration
GSE31811	The genes associated with the response to S-1,cisplatin and docetaxel combination chemotherapy (DCS therapy) for metastatic gastric cancer:
GSE31836	Global gene expression analysis in cord blood reveals gender-specific differences in response to carcinogenic exposure in utero
GSE31876	The differentially expressed genes in SRSF3 siRNA-treated HCT116 cells
GSE31905	Gene expression profiling of colorectal carcinoma
GSE32018	Gene-expression profile in a series of non-Hodgkin lymphoma (NHL) patients
GSE32062	Immune-activation as a therapeutic direction for patients with high-risk ovarian cancer based on gene expression signature (1)
GSE32063	Immune-activation as a therapeutic direction for patients with high-risk ovarian cancer based on gene expression signature (2)
GSE32138	The response of human primary airway epithelial cells to Influenza or RSV infection [hAECs_Agilent].
GSE32140	The response of PBMCs and primary airway epithelial cells to Influenza and RSV virus
GSE32155	Identification of the epithelial receptor for measles virus
GSE32181	A549 expression profile induced by high levels of extracellular GPBP-1
GSE32282	Transcrioptome analysis of human primary macrophages stimulated by bacterial endotoxin lipopolysaccharide (LPS), and (1,3)-b-glucans, curdlan and glucan from baker´s yeast (GBY)
GSE32414	Hypoxia-induced stem-like cancer cells resistance to VEGFR inhibition
GSE32507	Expression profile of carcinosarcoma (CS), endometrioid adenocarcinoma (EC) and sarcoma (US) of uterine corpus
GSE32531	Patient-derived tumor grafts authentically reflect tumor pathology, growth, metastasis, and disease outcomes (expression)
GSE32532	Patient-derived tumor grafts authentically reflect tumor pathology, growth, metastasis, and disease outcomes
GSE32541	Gene expression in a 3D skin tissue subjected to bystander alpha-particle irradiation
GSE32620	Human keratinocytes stimulated with IL-17C
GSE32643	Influence of cell permeable Tre-recombinase (CPTR) treatment on T-cell gene expression
GSE32662	DIFFERENTIAL GENE EXPRESSION OF MEDULLARY THYROID CARCINOMA REVEALS SPECIFIC MARKERS ASSOCIATED WITH GENETIC CONDITIONS.
GSE32923	The NIH Human Pluripotent Stem Cell Database (Agilent, mRNA)
GSE32968	Gene expression in human umbilical cord endothelial cells following FoxP1 knockdown
GSE32987	Gene expression profiles of DLD1 cells in which GATA6 or LGR5 expression was suppressed.
GSE32988	Gene expression analysis of T cell subsets from MS patients undergoing autologous hematopoietic stem cell transplantation reveals significant changes in immune function
GSE32993	Intralesional host response within eschars in Mediterranean spotted fever
GSE32999	Gene expression profiles due to common seed sequence of members of miR-302/372/373/520 family miRNAs and dsEcad640 in human PC-3 cells
GSE33026	Effect of heme on macrophage gene expression
GSE33048	Gene Expression profiles in Retinoblastoma
GSE33055	RIP-chip of HuR in MCF7 cells exposed to doxorubicin
GSE33193	Four subgroups by gene expression profile correlate with biological and clinical features in colorectal cancer.
GSE33218	Identification of dysregulated genes in 3D culture of BRIP1 knockdown cells
GSE33278	Molecular responses of human lung epithelial cells to the toxicity of copper oxide nanoparticles inferred from whole genome expression analysis.
GSE33293	miR-182 induced gene expression alteration in glioma cells
GSE33354	Changes in gene expression during acinar morphogenesis of normal-like human mammary epithelial cells in a 3D basement membrane cultures
GSE33479	Molecular characterisation of the multistep process of lung squamous carcinogenesis by gene expression profiling
GSE33482	Gene Expression Profile of Cisplatin Resistance in Ovarian Cancer Cell Lines
GSE33520	Whole genome expression profile of lung epithelial cells following chronic arsenic exposure
GSE33521	Gene expression profile of normoxic versus hypoxic HeLa cells
GSE33531	Gene expression profiling of prostate cells with CHD1 knockdown
GSE33566	The Peripheral Blood Transcriptome Predicts the Presence and Extent of Disease in Idiopathic Pulmonary Fibrosis
GSE33741	Gene expression signatures for Nanog-positive and Nanog-negative hepatocellular carcinoma cells
GSE33768	S100A8 treatment on gene expression of human umbilical vascular endothelial cells.
GSE33916	Identifying functional CpG island methylation markers in clear cell renal cell cancer cell lines
GSE34143	Gene expression of Epstein-Barr Virus (EBV) positive nodal peripheral T cell lymphoma, unspecified (PTCL-U)
GSE34200	The NIH Human Pluripotent Stem Cell Database
GSE34249	Cross-Species Comparisons of Transcriptomic Alterations in Human and Rat Primary Hepatocytes Exposed to 2,3,7,8-Tetrachlorodibenzo-p-dioxin: human samples
GSE34251	Cross-Species Comparisons of Transcriptomic Alterations in Human and Rat Primary Hepatocytes Exposed to 2,3,7,8-Tetrachlorodibenzo-p-dioxin
GSE34259	Study of the effect on indoxyl sulfate on endothelial gene expression
GSE34313	Airway smooth muscle reponse to dexamathasone at 4 and 24 hours
GSE34608	Gene and microRNA expression in pulmonary tuberculosis and sarcoidosis
GSE34674	cDNA microarray of hepatocellular carcinoma and nontumor liver tissues
GSE34822	Transcriptome Analysis in Patients with Progressive Coronary Artery Disease
GSE34870	Gene expression profiling of interferon-alpha-treated HTLV-1-infected CD4+ T cell lines
GSE34911	Characterization of T-rapamycin cells by gene expression profiling
GSE34933	Expression profiles in PCa And BPH from Chinese patients
GSE35030	TNF-α treated HUVECs: microRNA negative control VS. miR-181b
GSE35179	Gene expression profiles of monocytes derived from chronic lymphocytic leukemia patients and normal controls
GSE35186	Paradigm Test Set Expression Array
GSE35191	Paradigm Test Set
GSE35232	Transcription profile of adipose derived mesenchymal stem cells separated by cell surface protein N-cadherin.
GSE35279	Gene expression profiles in 74 laser microdissected colorectal cancer tissues
GSE35304	Comparison of the effects of GMCSF, IL-4 and 15kDa Granulysin on elutriated monocytes: a 48 hour time point analysis
GSE35602	microRNA and Gene expression profiles in colorectal cancer stromal tissue
GSE35635	Detection of circadian gene expression in human epidermal suction blister samples
GSE35728	Prolonged halting of gene expression in early G1 arrest by inhibition of CDK4/CDK6 reprograms myeloma cells for cytotoxic killing
GSE35818	A panel of hepatocellular carcinoma cell lines recapitulates the molecular subtypes of the human disease: A model for targeted drug development
GSE35862	Carnitine palmitoyltransferase 1A (CPT1A): a transcriptional target of PAX3-FKHR and mediates PAX3-FKHR-dependent motility in alveolar rhabdomyosarcoma cells
GSE35988	The Mutational Landscape of Lethal Castrate Resistant Prostate Cancer
GSE36014	Global changes in gene expression in primary keratinocytes after KLF9 overexpression
GSE36124	NPC stem-like cells [Agilent]
GSE36126	NPC stem-like cells
GSE36172	Gene expression profiling of human peripheral T cell lymphoma cases vs. reactive lymph nodes
GSE36364	Overexpression of CD157 contributes to epithelial ovarian cancer progression by promoting mesenchymal differentiation.
GSE36480	Confined 3D microenvironment regulates early differentiation in Human Pluripotent Stem Cells
GSE36532	Effects of choline intake and pregnancy on peripheral blood leukocyte gene expression
GSE36537	The multifaceted responses of human monocytes to IFN-gamma and IL-4 are not reducible to M1/M2 polarization of Macrophages
GSE36539	Interferon-related transcriptional program is induced by chronic hepatitis E infection in kidney-transplant recipients
GSE36563	Human pancreatic adenocarcinoma contains a side population resistant to gemcitabine
GSE37091	Gene signature of young and replicative senescent human umbilical vein endothelial cells (HUVECs)
GSE37093	MicroRNA and Gene signatures of young and replicative senescent human umbilical vein endothelial cells
GSE37123	Gene expression signatures of MEF2D-silencing hepatocellular carcinoma cells
GSE37126	Portrait of early-onset breast cancer in Brazilian patients: germline mutation screening of BRCA1, BRCA2 and TP53 genes and tumor expression profiling
GSE37231	LV-Induced Dendritic Cells for AML Immunotherapy
GSE37240	Effects of plasmids transfection on the RO82_W1 human thyroid cell line
GSE37389	Genomic and functional studies in T-Acute Lymphoblastic Leukemia patients exhibiting clonal T Cell Receptor γ and δ gene rearrangement
GSE37529	U937 scramble vs shHDAC2 upon SAHA (Vorinostat; suberoylanilide hydroxamic acid) treatment
GSE37531	Prostasphere-forming cells of human prostate cancer cell LNCaP: Control vs. Hormone treated
GSE37543	Subtype-specific response to bevacizumab is reflected in the metabolome and transcriptome of breast cancer xenografts
GSE37571	Host Regulatory Network Response in Calu-3 cell Infection with A/CA/04/2009 Influenza virus
GSE37615	Amniocytes (AM) vs. Immortalized AM
GSE37666	Granulomatous response to Coxiella burnetii, the agent of Q fever: Activation of type I interferon-related genes
GSE37761	Differentiation of Human Embryonic Stem Cells under Hypoxia Conditions
GSE37814	Gene expression profiling of macrophages: Implications for an immunosuppressive effect of dissolucytotic gold ions
GSE37827	SCL006,icSARS CoV Urbani or icSARS Bat SRBD (spike receptor binding domain from the wild type strain Urbani to allow for infection of human and non-human primate cells) infections of the 2B4 clonal derivative of Calu-3 cells - Time course
GSE37829	Acute host transcriptonal response to A/Texas/36/91 influenza and A/Texas/36/91 influenza containing the NS1 gene from r1918 in A549 cells
GSE37837	Genome-wide expression analysis of autologous eutopic and ectopic endometrium from fertile Indian women with endometriosis
GSE37945	Effect of HIC1 and miR-212/132 expression on MCF7 cells
GSE37951	Acute host transcriptonal response to r1918 influenza and r1918 influenza containing the NS1 gene from A/Texas/36/91 in A549 cells
GSE38008	AT13148 is a novel, oral multi-AGC kinase inhibitor with potent pharmacodynamic and antitumor activity
GSE38016	Effect of isoflavone agonists of IRF-3 on response to RNA viruses
GSE38174	A Study of the Gene Expression of Colorectal Liver Metastases: Tumour, ‘Halo’ and Liver Parenchyma
GSE38194	Orientia tsutsugamushi, the agent of scrub typhus, induces an inflammatory program in human macrophages
GSE38530	Gene expression data in over expressed Human Fetal Lung Fibroblasts with IPF downregulated miRNAs
GSE38537	IL-27, PXN, CXCR4, GZMA, PRF1 and Foxp3 genes are differentially expressed in CD4+ T cells of HTLV-1-infected individuals.
GSE38706	Evaluation of gene expression between CD44+ and CD44- cells in colonospheres
GSE38747	Regulatory role of multinucleated giant cells derived from placental CD14+ macrophages: Pathophysiological implications
GSE38769	Gene expression in primary isolated human myoblast during proliferation, G0 arrest, reactivation and differentiation
GSE38814	Glioblastoma Orthotopic Xenograft Transcriptome
GSE38924	MKN28 Cells: Vector vs ZIC1 Transfected
GSE39182	Epigenetic Silencing of DKK3 in Medulloblastoma.
GSE39242	Glioblastoma Orthotopic Xenograft Transcriptome and Glioblastoma Xenograft Comparative Genomic Hybridization Arrays
GSE39250	Increased levels of aneuploidy and deregulation of ploidy controlling genes are associated with maintained cultures of hMSC
GSE39290	Effects of maternal choline intake on placental gene expression
GSE39337	Distinct genetic alterations occur in ovarian tumor cells selected for combined resistance to carboplatin and docetaxel
GSE39356	MiR-374a Promotes Epithelial-Mesenchymal Transition (EMT) and Metastasis of Breast Cancer (mRNA dataset)
GSE39359	MiR-374a Promotes Epithelial-Mesenchymal Transition (EMT) and Metastasis of Breast Cancer
GSE39494	ABCC5 supports osteoclast formation and promotes breast cancer metastasis to bone
GSE39580	Proteo-Genomic Characterization and Mapping of Nucleosomes Decoded by Brd and HP1 Proteins (expression data)
GSE39581	Proteo-Genomic Characterization and Mapping of Nucleosomes Decoded by Brd and HP1 Proteins
GSE39668	Human prostate carcinoma cell line 22Rv1 overexpressing ESE1
GSE39681	Transcriptional imprinting of transmigrating neutrophils on T84 intestinal epithelial cells
GSE39698	Comparing control and IL17A treated A2780-derived ovarian cancer stem cell
GSE39828	Alteration of gene expression in HEK 293T cells upon inhibition of PCAF by embelin
GSE39829	Alteration of gene expression in two cell lines upon inhibition of PCAF by embelin
GSE40021	Expression data from 58 Synovial Sarcomas
GSE40025	Expression data from Synovial Sarcomas
GSE40060	HUVECs with endogenous or overexpressed GPR4 treated with pH 8.4 (control) or pH 6.4 for 5 h
GSE40074	Agilent 4x44K expression array for squamous cell carcinoma of the lung
GSE40089	Squamous cell carcinoma of the lung
GSE40098	RNA expression analysis of pancreatic cancer and non-malignant pancreas cell lines
GSE40099	Pancreatic cancer and non-malignant pancreas cell lines
GSE40152	The N-glycosylated isoform of β-integrin as a potential biomarker and target in HER-2+ BC refractory to HER-2 targeted therapies.
GSE40234	Genetic Risk Factors for Type 2 Diabetes: A Trans-Regulatory Genetic Architecture?
GSE40374	Gene expression in an EMT model using an immortalized bronchial epithelial cell line induced by TGF-β1
GSE40403	The downstream molecules of Notch signaling in vascular endothelial cell senescence
GSE40558	Involvement of transcription factor early growth response 4 (EGR4) in lung cancer bone metastasis
GSE40559	Gene expression profiles of 5 cancer cell lines
GSE40588	Gene expression profiling of tumor-adjacent histologically normal lung tissues from lung SCC patients
GSE40776	MGMT modulates glioblastoma angiogenesis and response to the tyrosine kinase inhibitor sunitinib
GSE40842	Comparison of gene expression profilling between iPS vs SSEA-1 positive or SSEA-1/3 negative sorted N417 cell line
GSE40844	ICL010 - Infection of Calu-3 cells with H1N1 influenza virus A/Netherlands/602/2009
GSE41289	Inter-individual variability in gene expression profiles in human hepatocytes and comparison with HepaRG cells
GSE41610	mRNA expression after siRNA-mediated knock down of Enhancer of zeste homolog 2 (Ezh2) in human umbilical vein endothelial cells
GSE41657	Gene expression profiling of colorectal normal mucosa, adenoma and adenocarcinoma tissues
GSE41685	WHIM Gene Expression Data_Update Through WHIM 26
GSE41726	Effects of sample size on differential gene expression, rank order and prediction accuracy of a gene signature
GSE41946	Decidual Endothelial Cells (DEC) and endothelial cells from human skin (ADMEC)
GSE41986	Immune and tumor cell gene expression from node positive and node negative breast cancers' primary tumor, lymph nodes and peripheral blood
GSE42024	Characterization of gene expression profiles induced by HIC-1 reactivation on breast cancer
GSE42030	Differential gene expression profile of newly diagnosed versus relapse acute promyelocytic leukemia
GSE42031	Comparison of gene expression profile of naive versus arsenic trioxide resistant acute promyelocytic leukemia cell line NB4
GSE42189	The Cytokines Interleukin-1 and Interferon-gamma Differentially Program Beta-glucan–activated Dendritic Cells via IkappaB-zeta Modulation
GSE42227	An eQTL study in the Japanese population [gene expression_1]
GSE42228	An eQTL study in the Japanese population [gene expression_2]
GSE42229	An eQTL study in the Japanese population [gene expression_3]
GSE42336	Gene expression in human prostate cancer cell lines regulated by HIC1 gene
GSE42488	Identification of single nucleotide polymorphisms regulating peripheral blood mRNA expression with genome-wide significance: an eQTL study in the Japanese population
GSE42507	Cluster analysis reveals differential transcript profiles associated with resistance training-induced human skeletal muscle hypertrophy
GSE42595	Gene expression changes induced by the pan-PIM inhibitor ETP-39010 in 4 peripheral T cell lymphoma cell lines
GSE42612	Quiescent Fibroblasts Exhibit High Metabolic Activity
GSE42613	A microRNA network regulates proliferative timing and extracellular matrix synthesis during cellular quiescence in fibroblasts [mRNA]
GSE42614	A microRNA network regulates proliferative timing and extracellular matrix synthesis during cellular quiescence in fibroblasts
GSE42650	EID1 knochdown by small RNA induces the large-scale conversion of adipose-derived mesenchymal stem cells into hematopoietic stem cells
GSE42922	TCR affinity-dependent functional inhibition via PD-1 and SHP-1 phosphatase
GSE42939	An integrative genomic and transcriptomic analysis reveals potential targets associated with cell proliferation in uterine leiomyomas
GSE42975	Novel dedifferentiated liposarcoma xenograft models reveal PTEN down regulation as a malignant signature and response to PI3K pathway inhibition
GSE42981	RIP: miR-202 mimic-transfected HeLa cells vs. negative control
GSE43076	Human lymphoblastoid cell lines: controls vs. patients with autism
GSE43090	Exression profiling of 9-cisRA in adrenocortical carcinoma cell line
GSE43136	Global gene expression analysis of peripheral blood cells, pluripotent cell lines, and iPS-derived T cells
GSE43146	ERβ activation by genistein promotes metastatic progression in prostate cancer
GSE43203	ICL0011 - Host response in human Calu-3 cells to infection with A/Vietnam/1203-CIP048_RG3/2004 (H5N1) (PB1-F2 deletion), A/Vietnam/1203-CIP048_RG3/2004 (H5N1) (PB2-627E mutant) or WT: A/Vietnam/1203/2004 (H5N1)
GSE43204	ICL0012 - Host response in human Calu-3 cells to infection with NS1trunc124: A/Vietnam/1203-CIP048_RG4/2004 (H5N1) or WT: A/Vietnam/1203/2004 (H5N1)
GSE43368	Phenotypic characterization of retinoic acid differentiated SH-SY5Y cells by transcriptional profiling
GSE43490	Transcriptional interaction network analyses in dorsal nucleus of vagus nerve, locus coeruleus and substantia nigra in Parkinson's disease
GSE43568	8 NSCLC cell lines treated with either 50nM or 100nM of AUY for 24 hours.
GSE43609	JAR cells: Control vs. siIMP1 transfected
GSE43640	KSHV microRNA transfection and human mRNA expression changes
GSE43696	Asthma
GSE43767	Comparison of gene expression profiling of human lung at four developmental stages and lung adenocarcioma
GSE44000	Transcriptome profile of subcutaneous adipocytes isolated from obese vs. lean postmenopausal women
GSE44044	Xi-reactivation in female human induced pluripotent stem cells (hiPSCs)
GSE44048	Human glioma cell line T98G: BAP-PCBP2 RIP vs. BAP-GFP RIP (Control)
GSE44066	Analyses of X-inactivation status in female human induced pluripotent stem cells
GSE44201	Gene expression in human peripheral blood 48 hours after exposure to ionizing radiation
GSE44210	Genome-wide analysis of host mRNA translation during hepatitis C virus infection
GSE44313	Gene expression Fulminant type 1 diabetes vs classical type 1A diabetes
GSE44314	gene expression Fulminant type 1 diabetes vs classical type 1A diabetes vs healthy controls
GSE44328	IL6 Related Cytokines Augment Angiogenesis in Nascent and Mature Human Endothelium Via JAK2 Signaling
GSE44354	Identification of novel metastases-suppressor genes involved in breast cancer brain metastases (BCBM) formation
GSE44370	mRNA and miRNA analysis during hepatitis C virus infection
GSE44371	Human MCF7 cells: Mock control vs. siRNA transfected against calreticulin
GSE44422	Transcriptomics in response to internal exposure in Flemisch adults
GSE44552	A panel of breast cell lines
GSE44581	Hedgehog pathway inhibition in chondrosarcoma using the Smoothened inhibitor IPI-926 directly inhibits sarcoma cell growth
GSE44670	Effect of GDF3 on NCCIT cells
GSE44728	miR-139-5p induced gene expression alteration in glioma cells
GSE44784	miR-29 affect on DC gene expression
GSE44805	Capturing the biological impact of the melanoma susceptibility genes CDKN2A and MC1R in cocultured keratinocytes and melanocytes
GSE44836	Gene expression profile of breast cancer cells.
GSE44838	Gene expression and methylation profile of breast cancer cells.
GSE45042	Cell host-response to infection with novel human coronavirus EMC predict potential antivirals and important differences with SARS-coronavirus.
GSE45171	Gene expression profile of endothelial cells maturated into brain-like endothelial cells
GSE45218	Gene Expression Test for Operational Renal Allograft Tolerance
GSE45375	Endothelial cells require miR-214 to secrete exosomes that suppress senescence and induce angiogenesis in human and mouse endothelial cells
GSE45485	Molecular Signatures in Skin Associated with Clinical Improvement During Mycophenolate Treatment in Systemic Sclerosis
GSE45493	MMP12 is induced by UVA1 in vivo in humans
GSE45581	Expression Analysis of Microdissected Inflammatory Breast Cancer
GSE45584	Expression Analysis and Genomic Analysis of Microdissected Inflammatory Breast Cancer
GSE45663	Leukemia Cell Lines Induce Changes in Bone Marrow Stromal Cells
GSE45729	Downregulation of miR-15b is associated with increased SIRT4 expression in premature senescence and photoaging of the skin
GSE45872	Hypoxia-enhanced Derivation of iPSCs from Human Dental Pulp Cells
GSE45979	A HUS-associated STEC expressing a dicA transcriptional module is related to gene network dysregulation in Caco-2
GSE46010	The gene expression change of RNF31 depletion in MCF-7 cells
GSE46171	Asthmatics with exacerbation during acute respiratory illness exhibit unique transcriptional signatures.
GSE46337	compare of mRNA expression between IA and MMA
GSE46338	compare of expression between IA and MMA
GSE46352	Caco-2 cells cultured in the presence of Lactobacillus fermentum strains AGR1485 or AGR1487
GSE46802	Global analysis of DNA methylation changes during progression of oral tumorigenesis
GSE47404	mRNA expression profiles of 71 esophageal squamous cell carcinoma cases
GSE47415	Gene expression in male and female smokers
GSE47460	Gene expression profiling of chronic lung disease for the Lung Genomics Research Consortium
GSE47467	The differentially expressed genes identified in oncospheres derived from CRC102 and its metastatic variants.
GSE47468	The differentially expressed genes identified in oncospheres derived from CRC105 and its metastatic variants.
GSE47469	The differentially expressed genes identified in oncospheres derived from CRC108 and its metastatic variants.
GSE47470	The differentially expressed genes identified in oncospheres derived from CRC cells and its metastatic variants
GSE47521	Gene expression microarray during Human NK cell development; 1-, 7- and 14-day cultured cells after differentiation induction
GSE47527	Effects of anti-IL13RA mAbs on IL-4 or IL-13 signalling
GSE47542	IMR90 lung fibroblasts treated with IL-4 or IL-13
GSE47591	Increased endoplasmic reticulum stress response is involved in clopidogrel-induced apoptosis of gastric epithelial cells
GSE47823	Chondrosarcoma cells: sphere vs adherent
GSE47897	Crosstalk between the effects of extracellular vesicles (Evs) and TNF on U937 human monocyte cell line
GSE47911	Gene expression signatures in gastric gastrointestinal stromal tumors (GISTs)
GSE47913	Integrated array CGH and expression profiling revealed candidate biomarkers in gastrointestinal stromal turmor
GSE47960	SHAE002: SARS-CoV, SARS-dORF6 and SARS-BatSRBD infection of HAE cultures.
GSE47961	SHAE003: SARS-CoV, SARS-dORF6 and SARS-BatSRBD infection of HAE cultures.
GSE47962	SHAE004: SARS-CoV, SARS-dORF6 and SARS-BatSRBD infection of HAE cultures.
GSE47963	SARS-CoV, SARS-dORF6 and SARS-BatSRBD infection of HAE cultures.
... Accession list truncated, click here to browse through all related public accessions You can also download a list of all accessions here

Relations

Alternative to

Alternative to

Alternative to

Alternative to

Data table header descriptions
ID	Agilent feature number
SPOT_ID	Spot identifier
CONTROL_TYPE	Control type
REFSEQ	RefSeq Accession number
GB_ACC	GenBank Accession number
GENE	Entrez Gene ID
GENE_SYMBOL	Gene Symbol
GENE_NAME	Gene Name
UNIGENE_ID	UnigeneID
ENSEMBL_ID	EnsemblID
TIGR_ID	TIGRID
ACCESSION_STRING	Accession String
CHROMOSOMAL_LOCATION	Chromosomal Location
CYTOBAND	Cytoband
DESCRIPTION	Description
GO_ID	GoIDs
SEQUENCE	Sequence

Data table

SPOT_ID

CONTROL_TYPE

REFSEQ

GB_ACC

GENE

GENE_SYMBOL

GENE_NAME

UNIGENE_ID

ENSEMBL_ID

TIGR_ID

ACCESSION_STRING

CHROMOSOMAL_LOCATION

CYTOBAND

DESCRIPTION

GO_ID

SEQUENCE

A_23_P100001

FALSE

NM_207446

400451

FAM174B

family with sequence similarity 174, member B

Hs.27373

ENST00000557398

ref|NM_207446|ens|ENST00000557398|ens|ENST00000553393|ens|ENST00000327355

chr15:93160848-93160789

hs|15q26.1

Homo sapiens family with sequence similarity 174, member B (FAM174B), mRNA [NM_207446]

GO:0016020(membrane)|GO:0016021(integral to membrane)

ATCTCATGGAAAAGCTGGATTCCTCTGCCTTACGCAGAAACACCCGGGCTCCATCTGCCA

A_23_P100011

FALSE

NM_005829

10239

AP3S2

adaptor-related protein complex 3, sigma 2 subunit

Hs.632161

ref|NM_005829|ref|NM_001199058|ref|NR_023361|ref|NR_037582

chr15:90378743-90378684

hs|15q26.1

Homo sapiens adaptor-related protein complex 3, sigma 2 subunit (AP3S2), transcript variant 1, mRNA [NM_005829]

TCAAGTATTGGCCTGACATAGAGTCCTTAAGACAAGCAAAGACAAGCAAGGCAAGCACGT

A_23_P100022

FALSE

NM_014848

9899

SV2B

synaptic vesicle glycoprotein 2B

Hs.21754

ENST00000557410

ref|NM_014848|ref|NM_001167580|ens|ENST00000557410|ens|ENST00000330276

chr15:91838329-91838388

hs|15q26.1

Homo sapiens synaptic vesicle glycoprotein 2B (SV2B), transcript variant 1, mRNA [NM_014848]

ATGTCGGCTGTGGAGGGTTAAAGGGATGAGGCTTTCCTTTGTTTAGCAAATCTGTTCACA

A_23_P100056

FALSE

NM_194272

348093

RBPMS2

RNA binding protein with multiple splicing 2

Hs.436518

ENST00000300069

ref|NM_194272|ens|ENST00000300069|gb|AK127873|gb|AK124123

chr15:65032375-65032316

hs|15q22.31

Homo sapiens RNA binding protein with multiple splicing 2 (RBPMS2), mRNA [NM_194272]

GO:0000166(nucleotide binding)|GO:0003676(nucleic acid binding)

CCCTGTCAGATAAGTTTAATGTTTAGTTTGAGGCATGAAGAAGAAAAGGGTTTCCATTCT

A_23_P100074

FALSE

NM_020371

57099

AVEN

apoptosis, caspase activation inhibitor

Hs.555966

ENST00000306730

ref|NM_020371|ens|ENST00000306730|gb|AF283508|gb|BC010488

chr15:34158739-34158680

hs|15q14

Homo sapiens apoptosis, caspase activation inhibitor (AVEN), mRNA [NM_020371]

GACCAGCCAGTTTACAAGCATGTCTCAAGCTAGTGTGTTCCATTATGCTCACAGCAGTAA

A_23_P100092

FALSE

NM_152455

146050

ZSCAN29

zinc finger and SCAN domain containing 29

Hs.418287

ENST00000396976

ref|NM_152455|ens|ENST00000396976|ens|ENST00000396972|gb|AF525399

chr15:43653388-43653329

hs|15q15.3

Homo sapiens zinc finger and SCAN domain containing 29 (ZSCAN29), mRNA [NM_152455]

AGAGAAACCCTATGGGTGTCATGACTGTGGTAAGTGCTTCAGTAAAAGCTCTGCCCTTAA

A_23_P100103

FALSE

NM_015289

23339

VPS39

vacuolar protein sorting 39 homolog (S. cerevisiae)

Hs.88025

ENST00000348544

ref|NM_015289|ens|ENST00000348544|ens|ENST00000318006|gb|AF280814

chr15:42453027-42452968

hs|15q15.1

Homo sapiens vacuolar protein sorting 39 homolog (S. cerevisiae) (VPS39), mRNA [NM_015289]

TGCATTTGCAAGATACCCCAATGGAGTGGTCGTCCATTACTTCTGTTCCAAAGAGGTAAA

A_23_P100111

FALSE

NM_007236

11261

CHP

calcium binding protein P22

Hs.406234

ENST00000392151

ref|NM_007236|ens|ENST00000392151|ens|ENST00000334660|gb|AK299660

chr15:41571553-41571612

hs|15q15.1

Homo sapiens calcium binding protein P22 (CHP), mRNA [NM_007236]

TAGAACAGAAAATGAGCATCCGATTTCTTCACTAAAGGAGACCAAACTGTTCCTTGCGGT

A_23_P100127

FALSE

NM_170589

57082

CASC5

cancer susceptibility candidate 5

Hs.181855

ENST00000260369

ref|NM_170589|ref|NM_144508|ens|ENST00000260369|ens|ENST00000533001

chr15:40917525-40917584

hs|15q15.1

Homo sapiens cancer susceptibility candidate 5 (CASC5), transcript variant 1, mRNA [NM_170589]

CGGTCTCTAGCAAAGATTCAGGCATTGGATCTGTTGCAGGTAAACTGAACCTAAGTCCTT

A_23_P100133

FALSE

NM_015251

23300

ATMIN

ATM interactor

Hs.16349

ENST00000299575

ref|NM_015251|ens|ENST00000299575|gb|AB007891|gb|CR749457

chr16:81079095-81079154

hs|16q23.2

Homo sapiens ATM interactor (ATMIN), mRNA [NM_015251]

GO:0005622(intracellular)|GO:0005634(nucleus)|GO:0006974(response to DNA damage stimulus)|GO:0008270(zinc ion binding)|GO:0046872(metal ion binding)

TGGACCTTCGTCAGCTTTGACACCTCTTTTCTGATTTAAAGACACCAAGGAAAACTACAA

A_23_P100141

FALSE

NM_023076

64718

UNKL

unkempt homolog (Drosophila)-like

Hs.643536

ENST00000397464

ref|NM_023076|ref|NM_001193388|ref|NM_001193389|ens|ENST00000397464

chr16:1415345-1415286

hs|16p13.3

Homo sapiens unkempt homolog (Drosophila)-like (UNKL), transcript variant 3, mRNA [NM_023076]

AGCAGAGGGGATCCAACGTCAGAGCTTTTAGAATTACTTTTTTAAGCAGCTGTCTTCTGG

A_23_P100156

FALSE

NM_017849

55654

TMEM127

transmembrane protein 127

Hs.164303

ENST00000432959

ref|NM_017849|ref|NM_001193304|ens|ENST00000432959|ens|ENST00000258439

chr2:96918149-96918090

hs|2q11.2

Homo sapiens transmembrane protein 127 (TMEM127), transcript variant 1, mRNA [NM_017849]

ACCTTCAGTGTAGATCCAGATGGCCAACCTGTCCTTGTTAAGTTACTTGCTTCTTGGGAA

A_23_P100177

FALSE

NM_002428

4324

MMP15

matrix metallopeptidase 15 (membrane-inserted)

Hs.80343

ENST00000219271

ref|NM_002428|ens|ENST00000219271|gb|D85510|gb|BC036495

chr16:58079526-58079585

hs|16q21

Homo sapiens matrix metallopeptidase 15 (membrane-inserted) (MMP15), mRNA [NM_002428]

GACCATTTGTTTCTGTTTCCCCGACTGGGGCAGGGTGTTTAGAATTTTCTAAATGTAGTT

A_23_P100189

FALSE

NM_002761

5619

PRM1

protamine 1

Hs.2909

ENST00000312511

ref|NM_002761|ens|ENST00000312511|gb|Y00443|gb|AY651260

chr16:11374862-11374803

hs|16p13.13

Homo sapiens protamine 1 (PRM1), mRNA [NM_002761]

GTAGAAGACACTAATTGCACAAAATAGCACATCCACCAAACTCCTGCCTGAGAATGTTAC

A_23_P100196

FALSE

NM_005153

9100

USP10

ubiquitin specific peptidase 10

Hs.136778

ENST00000219473

ref|NM_005153|ens|ENST00000219473|ens|ENST00000397953|ens|ENST00000540269

chr16:84812831-84812890

hs|16q24.1

Homo sapiens ubiquitin specific peptidase 10 (USP10), mRNA [NM_005153]

TTGGGGTTCGTGCACAACACAGCTTCTGTTGACTCTAACTTCCAAATCAAAATCATTTGG

A_23_P100203

FALSE

NM_001537

3281

HSBP1

heat shock factor binding protein 1

Hs.250899

ENST00000433866

ref|NM_001537|ens|ENST00000433866|gb|AK172732|gb|BX537440

chr16:83846244-83846303

hs|16q23.3

Homo sapiens heat shock factor binding protein 1 (HSBP1), mRNA [NM_001537]

GO:0000122(negative regulation of transcription from RNA polymerase II promoter)|GO:0003714(transcription corepressor activity)|GO:0005634(nucleus)|GO:0005856(cytoskeleton)|GO:0006936(muscle contraction)

ACAAATTACATGGGGAACATAAAGGAGTGAGATCCTTCTGTGATAAAATGAATTCACCAC

A_23_P100220

FALSE

NM_024939

80004

ESRP2

epithelial splicing regulatory protein 2

Hs.592053

ENST00000251366

ref|NM_024939|ens|ENST00000251366|gb|BC030146|gb|BC052309

chr16:68263113-68263054

hs|16q22.1

Homo sapiens epithelial splicing regulatory protein 2 (ESRP2), mRNA [NM_024939]

GO:0000166(nucleotide binding)|GO:0003729(mRNA binding)|GO:0005634(nucleus)|GO:0006397(mRNA processing)|GO:0043484(regulation of RNA splicing)

CTCAACTGCTGGCTCTTCTTCCCTTTGTATTTGTGTAAGGAGCACTGCACTCCCATAAAA

A_23_P100240

FALSE

NM_004062

1014

CDH16

cadherin 16, KSP-cadherin

Hs.513660

ref|NM_004062|ref|NM_001204744|ref|NM_001204745|ref|NM_001204746

chr16:66942101-66942042

hs|16q22.1

Homo sapiens cadherin 16, KSP-cadherin (CDH16), transcript variant 1, mRNA [NM_004062]

GO:0005509(calcium ion binding)|GO:0005886(plasma membrane)|GO:0007155(cell adhesion)|GO:0007156(homophilic cell adhesion)|GO:0016021(integral to membrane)

GGGAGTGCTCCAAATGTCAGGGTGTTTGCCCAATAATAAAGCCCCAGAGAACTGGGCTGG

A_23_P10025

FALSE

NM_006159

4753

NELL2

NEL-like 2 (chicken)

Hs.505326

ref|NM_006159|ref|NM_001145108|ref|NM_001145107|ref|NM_001145110

chr12:44902496-44902437

hs|12q12

Homo sapiens NEL-like 2 (chicken) (NELL2), transcript variant 2, mRNA [NM_006159]