GEO help: Mouse over screen elements for information.
Status
Public on Nov 21, 2015
Title
Agilent-074809 SurePrint G3 Mouse GE v2 8x60K Microarray [Probe Name version]
Technology type
in situ oligonucleotide
Distribution
custom-commercial
Organism
Mus musculus Manufacturer
Agilent Technologies
Manufacture protocol
see manufacturer's web site at http://www.agilent.com/
Description
Catalog gene expression microarray for Mouse, v2 8x60K
Submission date
Nov 20, 2015
Last update date
Mar 22, 2017
Organization
Agilent Technologies
E-mail(s)
cag_sales-na@agilent.com Phone
877-424-4536
URL
http://www.agilent.com Department
Street address
City
Palo Alto
State/province
CA
ZIP/Postal code
94304
Country
USA
Samples (4193)
GSM1946443 , GSM1946444 , GSM1946445 , GSM1946446 , GSM1946447 , GSM1946448
GSM1946449 ,
GSM1946450 ,
GSM1946451 ,
GSM1946452 ,
GSM1946453 ,
GSM1946454 ,
GSM2143865 ,
GSM2143866 ,
GSM2143867 ,
GSM2143868 ,
GSM2143869 ,
GSM2143870 ,
GSM2143871 ,
GSM2143872 ,
GSM2143873 ,
GSM2143874 ,
GSM2143875 ,
GSM2143876 ,
GSM2143877 ,
GSM2143878 ,
GSM2143879 ,
GSM2143880 ,
GSM2143881 ,
GSM2143882 ,
GSM2143883 ,
GSM2143884 ,
GSM2143885 ,
GSM2143886 ,
GSM2143887 ,
GSM2143888 ,
GSM2143889 ,
GSM2143890 ,
GSM2143891 ,
GSM2143892 ,
GSM2143893 ,
GSM2143894 ,
GSM2143895 ,
GSM2143896 ,
GSM2198186 ,
GSM2198187 ,
GSM2198188 ,
GSM2198189 ,
GSM2252091 ,
GSM2252092 ,
GSM2252093 ,
GSM2252094 ,
GSM2252095 ,
GSM2252096 ,
GSM2252097 ,
GSM2252098 ,
GSM2253767 ,
GSM2253768 ,
GSM2253769 ,
GSM2253770 ,
GSM2253771 ,
GSM2253772 ,
GSM2253773 ,
GSM2253774 ,
GSM2253775 ,
GSM2253776 ,
GSM2253777 ,
GSM2253778 ,
GSM2253779 ,
GSM2253780 ,
GSM2253781 ,
GSM2253782 ,
GSM2253783 ,
GSM2253784 ,
GSM2253785 ,
GSM2253786 ,
GSM2253787 ,
GSM2253788 ,
GSM2253789 ,
GSM2264166 ,
GSM2264167 ,
GSM2264168 ,
GSM2264169 ,
GSM2264170 ,
GSM2264171 ,
GSM2298850 ,
GSM2298851 ,
GSM2298852 ,
GSM2298853 ,
GSM2298854 ,
GSM2298855 ,
GSM2298856 ,
GSM2298857 ,
GSM2298858 ,
GSM2298859 ,
GSM2298860 ,
GSM2298861 ,
GSM2298862 ,
GSM2298863 ,
GSM2298864 ,
GSM2298865 ,
GSM2298866 ,
GSM2298867 ,
GSM2298868 ,
GSM2298869 ,
GSM2298870 ,
GSM2298871 ,
GSM2298872 ,
GSM2334727 ,
GSM2334728 ,
GSM2334729 ,
GSM2334730 ,
GSM2334731 ,
GSM2334732 ,
GSM2334733 ,
GSM2334734 ,
GSM2334735 ,
GSM2334736 ,
GSM2334737 ,
GSM2334738 ,
GSM2334739 ,
GSM2334740 ,
GSM2334741 ,
GSM2334742 ,
GSM2334743 ,
GSM2334744 ,
GSM2334745 ,
GSM2334746 ,
GSM2334747 ,
GSM2356935 ,
GSM2356936 ,
GSM2356937 ,
GSM2356938 ,
GSM2356939 ,
GSM2356940 ,
GSM2356941 ,
GSM2356942 ,
GSM2356943 ,
GSM2356944 ,
GSM2356945 ,
GSM2356946 ,
GSM2358611 ,
GSM2358612 ,
GSM2358613 ,
GSM2358614 ,
GSM2358615 ,
GSM2358616 ,
GSM2358617 ,
GSM2358618 ,
GSM2430786 ,
GSM2430787 ,
GSM2430788 ,
GSM2430789 ,
GSM2430790 ,
GSM2430791 ,
GSM2430792 ,
GSM2430793 ,
GSM2430794 ,
GSM2430795 ,
GSM2430796 ,
GSM2430797 ,
GSM2430798 ,
GSM2430799 ,
GSM2430800 ,
GSM2430801 ,
GSM2430802 ,
GSM2430803 ,
GSM2430804 ,
GSM2430805 ,
GSM2430806 ,
GSM2430807 ,
GSM2430808 ,
GSM2430809 ,
GSM2432277 ,
GSM2432278 ,
GSM2432279 ,
GSM2432280 ,
GSM2432281 ,
GSM2432282 ,
GSM2432283 ,
GSM2432284 ,
GSM2432285 ,
GSM2432286 ,
GSM2432287 ,
GSM2432288 ,
GSM2432289 ,
GSM2432290 ,
GSM2432291 ,
GSM2432292 ,
GSM2432293 ,
GSM2432294 ,
GSM2432295 ,
GSM2432296 ,
GSM2432297 ,
GSM2432298 ,
GSM2432299 ,
GSM2432300 ,
GSM2432301 ,
GSM2432302 ,
GSM2432303 ,
GSM2432304 ,
GSM2432305 ,
GSM2432306 ,
GSM2432307 ,
GSM2432308 ,
GSM2432309 ,
GSM2432310 ,
GSM2432311 ,
GSM2432312 ,
GSM2432313 ,
GSM2432314 ,
GSM2432315 ,
GSM2432316 ,
GSM2432317 ,
GSM2432318 ,
GSM2432319 ,
GSM2432320 ,
GSM2432321 ,
GSM2432322 ,
GSM2432323 ,
GSM2432324 ,
GSM2432325 ,
GSM2432326 ,
GSM2432327 ,
GSM2432328 ,
GSM2432329 ,
GSM2432330 ,
GSM2432331 ,
GSM2432332 ,
GSM2432333 ,
GSM2432334 ,
GSM2432335 ,
GSM2432336 ,
GSM2432337 ,
GSM2432338 ,
GSM2432339 ,
GSM2443870 ,
GSM2443871 ,
GSM2443872 ,
GSM2443873 ,
GSM2443874 ,
GSM2443875 ,
GSM2443876 ,
GSM2443877 ,
GSM2458786 ,
GSM2458787 ,
GSM2464309 ,
GSM2464310 ,
GSM2464311 ,
GSM2464312 ,
GSM2464313 ,
GSM2464314 ,
GSM2572779 ,
GSM2572780 ,
GSM2572781 ,
GSM2572782 ,
GSM2572783 ,
GSM2572784 ,
GSM2572785 ,
GSM2572786 ,
GSM2589586 ,
GSM2589587 ,
GSM2589588 ,
GSM2589589 ,
GSM2589590 ,
GSM2589591 ,
GSM2589592 ,
GSM2589593 ,
GSM2589594 ,
GSM2651032 ,
GSM2651033 ,
GSM2651034 ,
GSM2651035 ,
GSM2651036 ,
GSM2651037 ,
GSM2651038 ,
GSM2651039 ,
GSM2651040 ,
GSM2651041 ,
GSM2651042 ,
GSM2651043 ,
GSM2651044 ,
GSM2651045 ,
GSM2651046 ,
GSM2651047 ,
GSM2683083 ,
GSM2683084 ,
GSM2683085 ,
GSM2683086 ,
GSM2683087 ,
GSM2683088 ,
GSM2702093 ,
GSM2702094 ,
GSM2702095 ,
GSM2702096 ,
GSM2702097 ,
GSM2702098 ,
GSM2702099 ,
GSM2702100 ,
GSM2702101 ,
GSM2702102 ,
GSM2702103 ,
GSM2702104 ,
GSM2702105 ,
GSM2702106 ,
GSM2702107 ,
GSM2702108 ,
GSM2702109 ,
GSM2702110 ,
GSM2702111 ,
GSM2702112 ,
GSM2702113 ,
GSM2702114 ,
GSM2702115 ,
GSM2702116 ,
GSM2702251 ,
GSM2702252 ,
GSM2702253 ,
GSM2702254 ,
GSM2702255 ,
GSM2702256 ,
GSM2702257 ,
GSM2702258 ,
GSM2702259 ,
GSM2702260 ,
GSM2702261 ,
GSM2702262 ,
GSM2702263 ,
GSM2702264 ,
GSM2702265 ,
GSM2702266 ,
GSM2702267 ,
GSM2702268 ,
GSM2702269 ,
GSM2702270 ,
GSM2702271 ,
GSM2702272 ,
GSM2702273 ,
GSM2702274 ,
GSM2702275 ,
GSM2702276 ,
GSM2702277 ,
GSM2702278 ,
GSM2702279 ,
GSM2702280 ,
GSM2702281 ,
GSM2702282 ,
GSM2702283 ,
GSM2702284 ,
GSM2702285 ,
GSM2705574 ,
GSM2705575 ,
GSM2705576 ,
GSM2705577 ,
GSM2706268 ,
GSM2706269 ,
GSM2706270 ,
GSM2706271 ,
GSM2706272 ,
GSM2706273 ,
GSM2706274 ,
GSM2706275 ,
GSM2706276 ,
GSM2706277 ,
GSM2706278 ,
GSM2706279 ,
GSM2706280 ,
GSM2706281 ,
GSM2706282 ,
GSM2706283 ,
GSM2715527 ,
GSM2715528 ,
GSM2747012 ,
GSM2747013 ,
GSM2747014 ,
GSM2747015 ,
GSM2747016 ,
GSM2747017 ,
GSM2747018 ,
GSM2747019 ,
GSM2775076 ,
GSM2775077 ,
GSM2775078 ,
GSM2775079 ,
GSM2784707 ,
GSM2784708 ,
GSM2784709 ,
GSM2784710 ,
GSM2784711 ,
GSM2784712 ,
GSM2784713 ,
GSM2784714 ,
GSM2790249 ,
GSM2790250 ,
GSM2790251 ,
GSM2790252 ,
GSM2790253 ,
GSM2790254 ,
GSM2790255 ,
GSM2790256 ,
GSM2790257 ,
GSM2790258 ,
GSM2790259 ,
GSM2790260 ,
GSM2790261 ,
GSM2790262 ,
GSM2790263 ,
GSM2790264 ,
GSM2790265 ,
GSM2790266 ,
GSM2790267 ,
GSM2790268 ,
GSM2790269 ,
GSM2790270 ,
GSM2790271 ,
GSM2790272 ,
GSM2803997 ,
GSM2803998 ,
GSM2803999 ,
GSM2804000 ,
GSM2804001 ,
GSM2804002 ,
GSM2804003 ,
GSM2804004 ,
GSM2804005 ,
GSM2804006 ,
GSM2804007 ,
GSM2804008 ,
GSM2804282 ,
GSM2804283 ,
GSM2804284 ,
GSM2811329 ,
GSM2811330 ,
GSM2811331 ,
GSM2811332 ,
GSM2811333 ,
GSM2811334 ,
GSM2825803 ,
GSM2825804 ,
GSM2825805 ,
GSM2825806 ,
GSM2825807 ,
GSM2825808 ,
GSM2825809 ,
GSM2825810 ,
GSM2825811 ,
GSM2825812 ,
GSM2825813 ,
GSM2825814 ,
GSM2825815 ,
GSM2825816 ,
GSM2825817 ,
GSM2866535 ,
GSM2866536 ,
GSM2866537 ,
GSM2866538 ,
GSM2866539 ,
GSM2866540 ,
GSM2866541 ,
GSM2866577 ,
GSM2866578 ,
GSM2866918 ,
GSM2866919 ,
GSM2866920 ,
GSM2866921 ,
GSM2866922 ,
GSM2866923 ,
GSM2866924 ,
GSM2866925 ,
GSM2901735 ,
GSM2901736 ,
GSM2901737 ,
GSM2901738 ,
GSM2901739 ,
GSM2901740 ,
GSM2901741 ,
GSM2901742 ,
GSM2901743 ,
GSM2901744 ,
GSM2901745 ,
GSM2901746 ,
GSM2901747 ,
GSM2901748 ,
GSM2901749 ,
GSM2935997 ,
GSM2935998 ,
GSM2935999 ,
GSM2936000 ,
GSM2936001 ,
GSM2936002 ,
GSM2936003 ,
GSM2936004 ,
GSM2978438 ,
GSM2978439 ,
GSM2978440 ,
GSM2978441 ,
GSM2978442 ,
GSM2978443 ,
GSM2978444 ,
GSM2978445 ...
Accession list truncated, click here to browse through all related public accessions You can also download a list of all accessions here Series (304)
GSE75233 Targeting Focal Adhesion Kinase Renders Pancreatic Cancers Responsive to Checkpoint Immunotherapy
GSE81153 Fetal and neonatal hematopoietic progenitors are functionally and transcriptionally resistant to Flt3-ITD mutations.
GSE83283 Microarray expression data from WT and Irf4-/- CD4+ T cells after activation
GSE84840 CRISPR/Cas9-mediated genome editing in wild-derived mice; Generation of tamed wild-derived strains by mutation of the a (nonagouti) gene
GSE84901 Gene expression in murine alveolar macrophage: effect of aging and influenza infection
GSE85290 Cochlear transcriptome after noise trauma and dexamethasone therapy in mice
GSE86230 Effect of cardiomyocyte specific KO of AKT1 + AKT2 on gene expression profile of the heart
GSE86231 Effect of cardiomyocyte specific KO of AKT1, AKT2, and AKT1 + AKT2 on gene expression profile of the heart
GSE87579 Conversion of terminally committed mouse hepatocytes to culturable bipotent progenitor cells
GSE87764 Chemical induction of liver progenitor cells from mature hepatocytes
GSE88999 Gene expression profiling of differentially treated hematopoietic stem cells (LSK SLAM)
GSE89091 The effect of Bcl6 on the liver sex difference
GSE92502 Liver transcriptomic response to fasting, high glucose or a high fructose challenges in wild-type C57Bl/6J male mice
GSE92563 Transcriptomics effects of ingestion of food additive titanium dioxide (E171) in the colon of BALB/c mice
GSE92613 CBP/p300 transcriptome
GSE93105 Investigation of molecular events underlying the IL-6-mediated Th1 inhibition in tumor-bearing mice
GSE93615 Expression profiles of Brg1-depleted acinar cells during ductal conversion
GSE93869 Therapeutic effects of telomerase in mice with pulmonary fibrosis induced by damage to the lungs and short telomeres
GSE97593 Gene expression changes in adult mouse cardiomyocytes when Brg1 and Brm are knocked out
GSE98226 Gene expression of cardiac tissues in dietary obese mice administered with a dipeptidyl peptidase-4 inhibitor
GSE99731 Comprehensive Expression Analysis of microRNAs and mRNAs in Osteoarthritic Synovial Tissue from a Mouse Model of Early Post-Traumatic OA [mRNA]
GSE99738 Comprehensive Expression Analysis of microRNAs and mRNAs in Osteoarthritic Synovial Tissue from a Mouse Model of Early Post-Traumatic OA
GSE100435 Colorectal Cancer-derived Small Extracellular Vesicles Create an Inflammatory Pre-metastatic Niche through Macrophage Polarization in Liver Metastasis
GSE101405 In vivo metabolic disorders induced by a pesticide cocktail at the Acceptable Daily Intake level
GSE101411 Transcriptomic analysis of mice treated with Lactobacillus rhamnosus CNCM i-3690 and different mutants and variants generated from this strain
GSE101530 Aristolochic acid nephropathy induced by aristolochic acid type I in C57BL/6 mice
GSE101573 Cartilage microRNA dysregulation during the onset and progression of mouse osteoarthritis is independent of aggrecanolysis and overlaps with candidates from end-stage human disease [mRNA]
GSE101574 Cartilage microRNA dysregulation during the onset and progression of mouse osteoarthritis is independent of aggrecanolysis and overlaps with candidates from end-stage human disease
GSE101787 Analysis of the gene expression of the mouse after different heat-induced treatment
GSE102833 Expression profiling macrophage subsets [P1750]
GSE102836 Expression profiling macrophage subsets
GSE103597 ALDH high activity or low activity cell in 4T1 bearing mice
GSE103856 Expression data from lung and spleen natural killer cells of WT and Kras mice
GSE104121 Radiation-induced molecular alterations after whole body irradiation in a mouse model
GSE104603 Expression data from Imiquimod-induced psoriasis mouse model
GSE104626 Gene expression profiling in Hepa1c1c7 transfected Mst1r or Slpi
GSE104979 Vascular endothelial cells (VECs) and lymphatic endothelial cells (LECs) of small intestines
GSE105417 Selective inhibition of JAK1 with filgotinib reverses pathogenic processes in the DSS preclinical model for IBD
GSE106828 Podocyte-specific deletion of tubular sclerosis complex 2 causes focal segmental glomerular sclerosis and progressive renal failure
GSE107414 Gene expression analysis of murine pluripotent stem cells treated with myxothiazol for 12 h
GSE107416 LincU Preserves Naive Pluripotency by Restricting ERK Activity in Embryonic Stem Cells [knockdown]
GSE107418 LincU Preserves Naive Pluripotency by Restricting ERK Activity in Embryonic Stem Cells
GSE107435 The effect of Bcl6 on liver sex difference
GSE108494 Immune response induced by an HSV-1 mutant strain: a discrepancy analysis of immune system gene profile in comparison with a wild type virus strain
GSE109259 Expression data in ischemic brain tissue and brain Tregs
GSE109520 Transcriptomics effects of ingestion of food additive titanium dioxide (E171) in the colon of a chemically induced colorectal cancer model
GSE110141 Gene expression signatures before or after transient middle cerebral artery oclussion (tMCAO) in ZEB1 transgenic and wild type mice
GSE110181 Essential role of Arid1a in intestinal stem cell maintenance and homeostasis through Sox9 regulation
GSE111451 Bilophila wadsworthia worsens high-fat diet-induced metabolic impairments in inflammation dependent and independent manners [mouse gene expression]
GSE111757 In vivo microarray expression data from WT, Irf4-/- and checkpoint blockade treated Irf4-/- TEa CD4+ T cells
GSE112140 Comparative hepatic transcriptome analyses revealed possible pathogenic mechanisms of fasiglifam (TAK-875)-induced acute liver injury in mice
GSE112388 Bilophila wadsworthia worsens high-fat diet-induced metabolic impairments in inflammation dependent and independent manners
GSE112683 Time course of gene expression of peritoneal macrophage from wild-type or LysM-St18flox mice after LPS stimulation
GSE112684 Gene expression of wild-type or LysM-St18flox M-CSF-derived macrophage or osteoclast
GSE112742 Murine mammary gland: PRA transgenics vs. wild-type
GSE112916 Analysis of gene expression in naïve T cells stimulated by cross-linking with both anti-CD3 and anti-CD155 antibodies
GSE113249 Gene expression signatures for murine stromal cells from tumor-draining lymph nodes
GSE113250 Gene expression signatures for murine B cells from tumor-draining lymph nodes
GSE113693 Connexin 30 deficiency attenuates A2 astrocyte responses and induces severe neurodegeneration in a 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine hydrochloride Parkinson’s disease animal model
GSE113820 Comparative transcriptomic profiling of peripheral efferent and afferent nerve fibres at different developmental stages in mice
GSE114005 Gene expression data in mouse whole lung
GSE114010 ER beta regulated transcriptome in endometriotic tissues
GSE115068 Aging-associated gene expression profiling in adipose tissue derived mesenchymal stem cells.
GSE115113 Kdm6 inhibitor as leptin sensitizer in the hypothalamus of high fat diet induced obesity mice
GSE115392 The effect of type I IFN treatment on global gene expression in monocytes undergoing maturation
GSE116416 Transcriptome analysis in the medial prefrontal cortex of mice exposed to multi-hit early adversity
GSE116417 Liver gene expression profiling of obese C57BL/6J mice after chronic exposure to ethanol.
GSE116504 Augmented Pla2g4c/Ptgs2/Hpgds Axis in Bronchial Tissues of Experimental Asthma
GSE116739 Wnt/β-catenin signaling, which is activated in odontomas, reduces Sema3A expression to regulate odontogenic epithelial cell proliferation and tooth germ development
GSE116926 Gene expression in BMSCs isolated from NONMMUT002667 gene KO mice and wildtype control mice
GSE117257 Establishment of a novel mouse model of troglitazone-induced liver injury and analysis of its hepatotoxic mechanism
GSE117630 Acute lung injury models identify putative growth factors that promote tissue repair and biomarkers for acute lung injury
GSE117740 Freeze-dried mouse sperm nucleus has tolerance against extreme environments
GSE118072 Effect of Fumonisin B1 on hepatic transcriptome in WT and LXR KO female mice
GSE118986 Comparison of gene expression profiles between Dock8+/– and Dock8–/– (tcr)AND Tg DRG (dorsal root ganglion) neurons
GSE119227 Intraepithelial papillary neoplasia in the biliary tree is mediated by FGF10 signal
GSE120626 Expression profiles of Ecrg4hetero beta-gal positive neurosphere and Ecrg4hetero beta-gal positive VZ/SVZ
GSE120814 JunB plays a crucial role in the development of regulatory T cells by regulating interleukin-2 signaling
GSE121335 A novel animal model for secondary progressive multiple sclerosis by oligodendroglia-specific conditional connexin 47 knockout [Agilent]
GSE121339 A novel animal model for secondary progressive multiple sclerosis by oligodendroglia-specific conditional connexin 47 knockout
GSE121779 Analysis if IGF1-mediated cardioprotection after acute myocardial infarction in C57BL6/J mice
GSE122430 Gene expression profiles of maresin 1-treated Kupffer cells
GSE123289 Effect of GLUT1 deletion in myeloid deficient bone marrow derived macrophage LysM-Cre X Slc2a1 model
GSE123354 Effect of HFD exposure on hepatic transcriptome on Wild Type mice (WT), hepatocyte-specific PPARα knockout mice (LKO) and whole body PPARα knockout mice (KO).
GSE123413 Gene expression profiling during adhesion formation induced by cecum cauterization
GSE123549 Gene expression profile of IFNα transgenic mice
GSE123556 Pattern of miR-31 knockout mouse colon gene expression
GSE123802 Comparison of target genes from the pregnane X receptor (Pxr) in the liver vs the intestine [liver]
GSE123803 Comparison of target genes from the pregnane X receptor (Pxr) in the liver vs the intestine [ileum]
GSE123804 Comparison of target genes from the pregnane X receptor (Pxr) in the liver vs the intestine
GSE123963 Comparison of target genes from the pregnane X receptor (Pxr) in the liver vs the intestine [colon]
GSE124433 Site-specific microarray evaluation of spontaneous dermatitis in flaky tail mice I
GSE124434 Site-specific microarray evaluation of spontaneous dermatitis in flaky tail mice II
GSE124813 Effect of Astragalus Polysaccharide Combined with Metformin on Liver mRNA expression profile in aging type 2 diabetic mice and functional analysis
GSE126725 Diffuse glioma cells with perineural satellitosis invade by mediating metabolic reprogramming
GSE127258 Gene expression changes in tumor following ADH-503 treatment
GSE127686 Comparison of gene expression profiles between S100A4-positive and -negative cells isolated from the Peyer's patches
GSE127907 GTF2I mutation induces metabolic alterations and cell transformation in thymic epithelial cells [I]
GSE127908 GTF2I mutation induces metabolic alterations and cell transformation in thymic epithelial cells [II]
GSE127909 Mutant GTF2I induces cell transformation and metabolic alterations in thymic epithelial cells
GSE128124 Apatite nanoparticle(sCA)-siTIMP1 delivery in NIH3T3
GSE129048 FGF2-mediated regulation of TGF-β-induced endothelial-to-myofibroblast transition
GSE129656 Gene expression profiling of cardiac mesenchymal stromal cell during ageing
GSE130191 Respiratory chain inactivation links cartilage-mediated growth retardation to mitochondrial diseases
GSE130347 Murine model of oxygen-induced retinopathy - 3 time points [blood]
GSE130362 Recombinant humant thrombomodulin treatment against endotoxemia-induced acute respiratory distress syndrome (ARDS).
GSE130496 The effect of carbon fiber after 1 month instillation on mouse
GSE130498 The effect of carbon fiber after 1 or 6 months instillation on mouse
GSE130755 Gene expression changes in astrocytes by pulsed radiofrequency: a possible mechanism of neuropathic pain improvement
GSE131266 Transcriptome analysis of isolated glomeruli from obese type 2 diabetic mice treated with enarodustat
GSE131292 JunB plays a crucial role in the development of regulatory T cells by increasing a sensitivity to interleukin-2
GSE131346 Gene expression profiles between miRNA Negative control-treated and miR-124a-3p mimic treated-teratomas
GSE131437 Recombinant human thrombomodulin treatment against endotoxemia-induced myocardial injury
GSE131958 Obesity accelerates hair thinning in stem cell-centric converging mechanism
GSE132004 Gene expression profiles in CT26 syngeneic tumor tissues after EP4 antagonist TP-16(BY001), anti-PD-1 antibody or combination treatment
GSE132599 Effect of Astragalus Polysaccharide Combined with Metformin on Liver mRNA expression profile in aging type 2 diabetic mice and functional analysis
GSE133279 Silica materials effect on Bhas 42 cell transformation
GSE133596 Deficiency of C3a receptor attenuates the development of diabetic nephropathy (Control Group)
GSE133597 Deficiency of C3a receptor attenuates the development of diabetic nephropathy (Diabetic Group)
GSE133598 Deficiency of C3a receptor attenuates the development of diabetic nephropathy
GSE134257 Gene expression profiles in hippocampus with or without neuronal PGC-1α overexpression
GSE135191 5/6 nephrectomy (5/6Nx) effect on the splenic monocytes in mouse
GSE135259 Pattern of Islr knockout mouse colon gene expression
GSE135859 Epithelial EP4 plays an essential role in maintaining homeostasis in colon
GSE136212 Paternal knockout of Slc38a4/SNAT4 causes placental hypoplasia associated with intrauterine growth restriction in mice
GSE136594 Target gene profiles of 1,25(OH)2D3 and 25(OH)D3 in Cyp27b1 knockout mDCT cells.
GSE136937 Changes in gut microbiota induced by oral pathobiont deteriorate the pathology of non-alcoholic fatty liver disease
GSE137581 Novel mirnas participate in Atherosclerosis through inflammation and apoptosis pathways (Mouse mRNA)
GSE137817 Cochlear transcriptome at 3 hours post-noise trauma in mice
GSE138336 Investigate the gene expression profiles of oral sublingual DC and macrophage subsets
GSE138916 Analysis of differentially expressed genes in intrahepatic HBsAg accumulating mice
GSE138972 The C5a signaling triggers functional intracellular signaling in C5aR+ LysoDCs
GSE139167 Gene expression profiles of Dclk1+ and Dclk1- PDAC cells
GSE139317 Enarodustat, a hypoxia-inducible factor stabilizer, counteracts the diabetic renal energy metabolism alterations in the early stages of diabetic kidney disease
GSE140492 Influence of hsd17b4 knockout in gene expression of RAW 264.7 cells
GSE140706 5/6 nephrectomy (5/6Nx) effect on the splenic monocytes in mouse
GSE141643 Characterization of Interleukin 11-producing fibroblasts that constitute a niche for tumor development [Agilent]
GSE141644 Characterization of Interleukin 11-producing fibroblasts that constitute a niche for tumor development
GSE141826 SO018 muscle gene expression
GSE142070 murine jejunal and ileal epithelial tissue
GSE142260 Gene expression profiles of mice dendritic cell infected by Enterovirus 71
GSE142297 Global mammary luminal cells gene expression data from C451A-ERα and WT female mice treated by E2 or E2+Pg during 21 days.
GSE142421 Hyperuricemia Predisposes to the Onset of Diabetes
GSE142594 Role of Sting in a lupus mouse model of Fcgr2b-deficient mice
GSE142624 Gene expression of splenocytes in collagen-induced arthritis (CIA) model between Wildtype and Stinggt/gt mice.
GSE144459 Identifying blood transcriptome biomarkers of Alzheimer’s disease using transgenic mice
GSE145620 SO018 liver gene expression
GSE145775 Setdb1 is required for formation of pancreatic ductal adenocarcinoma by inhibiting p53-mediated apoptosis in mice
GSE146094 Porphyromonas gingivalis affect gene expression in skeletal muscle, tibialis anterior muscle.
GSE146614 DYRK2 knockout mice exhibit fetal growth retardation
GSE146635 Porphyromonas gingivalis affects gene expression in skeletal muscle, soleus muscle
GSE146969 Development of gene expression signatures for barrier recovery phase in epidermis from acute barrier disruption
GSE147269 Gene expression in islets from βUCP2Tg mice and WT mice
GSE147709 Trp53 mutation in Krt5-expressing basal cells facilitates the development of basal squamous-like invasive bladder cancer in the chemical carcinogenesis of mouse bladder
GSE147835 pattern of miR-22 knockout mouse BAT gene expression
GSE148868 Bisphenol A and membrane estrogen receptor activation in the mammalian preimplantation embryo
GSE148929 Gray but not white matter astroglia-specific connexin 43 ablation ameliorates neuroinflammation [Agilent]
GSE148932 Gray but not white matter astroglia-specific connexin 43 ablation ameliorates neuroinflammation
GSE150094 5/6 nephrectomy (5/6Nx) effect on the cardiac ventricle in mouse
GSE150447 Effects of 4-nitrophenol on testicular somatic cells [TM3]
GSE150448 Effects of 4-nitrophenol on testicular somatic cells [TM4]
GSE150449 Effects of 4-nitrophenol on testicular somatic cells
GSE150694 Effects of various causes, such as aging, smoking, and epithelial damage, on the global gene expression profiles of the mouse nasal mucosa and olfactory bulb
GSE151367 MicroRNA and mRNA integrated transcriptional analysis in a Cx30-/- mouse model of non-syndromic hearing loss and deafness [mRNA]
GSE151369 MicroRNA and mRNA integrated transcriptional analysis in a Cx30-/- mouse model of non-syndromic hearing loss and deafness
GSE152769 Gene expression profiles in BV2 cells with or without PGC-1α overexpression after LPS stimulation
GSE152871 Gene expression profiles in microglia with or without PGC-1α overexpression after acute ischemic stroke (AIS)
GSE153148 Testosterone deficiency altered mortality and the expression profile of protease inhibitors in an elastase-induced mouse model of emphysema
GSE153516 Endotoxemia by P. gingivalis change endocrine in brown adipose tissue
GSE153926 Gene expression profiles of wild type and Nr4a-triple knockout (Nr4a-TKO) Tnaive and iTreg 3 h
GSE153928 Roles of Nr4a family transcription factors in Th and Treg cell differentiation from Tnaive cells
GSE154478 Gene expression profiles of MIN6 cells treated with vehicle (PBS) or Maidong polysaccharide extract (MPE) for 3 days
GSE154592 Gene expression in gamma-glutamylcyclotransferase-overexpressing mouse embryonic fibroblast NIH3T3 cells.
GSE154724 Gene expression profiles in Agpat3 KO liver
GSE155097 Bach1-silenced and control C2C12 cells before and after inducing differentiation
GSE155355 Effect of nanosecond pulsed electric field (nsPEF) on gene expression in TM3 Leydig cells
GSE155425 Gene expression profiling of cerebellums in the central nervous system-specific Derlin-1 or Derlin-2 deficient mice
GSE155632 Analysis of CD8+ T cell of BCD mice
GSE156522 Inhibition of Gli2 suppresses tumorigenicity in glioblastoma stem cells derived from a de novo murine brain cancer model
GSE156646 Comprehensive profiling of gene expression in the cerebral cortex and striatum of BTBRTF/ArtRbrc mice compared to C57BL/6J mice
GSE156837 The pregnane X receptor drives sexually dimorphic hepatic changes in lipid and xenobiotic metabolism in response to gut microbiota in mice
GSE156982 Dynamin-related protein 1 deficiency accelerates lipopolysaccharide-induced acute liver injury and inflammation in mice
GSE157472 Expression data of Tfe3/Tfeb- or GFP-knocked-down RAW264 macrophages treated with or without iron
GSE157993 Cyclodextrin-derived Nano-medicine Suppresses the Progression of Colorectal Cancer
GSE158270 Effects of maoto (ma-huang-tang) on transcriptome signature in influenza virus infection
GSE158807 Ultra-low dose aerosol infection provides an improved murine model of tuberculosis
GSE159086 Effect of pemafibrate on liver gene expression in wild-type mice and in mice with hepatocyte-restricted deletion of PPARalpha
GSE159089 Effect of hepatocyte-restricted deletion of PPARalpha on liver gene expression in response to fasting in mice from both sexes
GSE159090 Effect of six different diets on liver gene expression
GSE159240 Gene expression profile of DOCK8+CD4 T cell which causes systemic lupus erythematosus
GSE159420 Kidney GATA3+ regulatory T cells play roles in the convalescence stage after antibody-mediated renal injury
GSE159748 Restoration of type I interferon signaling in intrahepatically primed CD8+ T cells promotes functional differentiation
GSE160929 Recombinant Anti-thrombin treatment against endotoxemia-induced acute respiratory distress syndrome (ARDS).
GSE161017 Impact of copper oxide particle dissolution on lung epithelial cell toxicity: response characterization using global transcriptional analysis
GSE161182 Conditional Ror1 knockout reveals crucial involvement in lung adenocarcinoma development and identifies novel HIF-1α regulator
GSE161659 Aging affects gene expression in CD8 T-cells from mice with or without MC38 tumors
GSE161660 Characterization of CD44low CD62Llow CD8 T-cell subset
GSE161869 A Heated tobacco product ‘IQOS’ exposure enhances apoptosis and emphysema in mice lungs
GSE161885 Gene expression changes induced by over-expression of miR-181b-5p in db/db mouse
GSE161886 Expression Signatures of diabetic mouse and miR-181b-5p overexpression in db/db mouse
GSE162376 Changes in Gene Expression Profiling and Phenotype in Aged Multidrug Resistance Protein 4-Deficient Mouse Retina
GSE163918 Gene expression signatures for GP73-induced non-obese nonalcoholic fatty liver disease
GSE164572 Card9 protects zymosan-induced peritonitis through regulating autophagy in macrophage
GSE165154 Effect of Insulin receptor deletion in hepatocytes on liver gene expression at three distinct time points in male mice (C57BL/6J) fed ad libitum a chow diet
GSE165155 Effect of Insulin receptor deletion in hepatocytes on liver gene expression at different time point in mice either fed ad libitum or upon day-restricted feeding
GSE165156 The hepatocyte insulin receptor is required to program rhythmic gene expression and the liver clock
GSE165558 Effect of beta3 adrenergic activation on liver gene expression profile in mice (C57Bl/6J) expressing hepatocyte PPARalpha or not
GSE165699 Liver gene expression profile in mice (C57Bl/6J) lacking ATGL in white adipose tissue in response to feeding, fasting or beta 3 adrenergic stimulation with CL316243
GSE166057 Agilent SurePrint G3 Mouse GE V2.0 Microarray(8*60K,Design ID:074809)
GSE166821 J774.1 mouse macrophage-like cell line: Control vs. IR or TAM or Torin1
GSE167010 Modulations of mTORC2-GATA3 is by isorhamnetin activates endosomal-lysosomal degradation in J774.1 macrophage-like cell line
GSE168085 p38α plays differential roles in hematopoietic stem cell activity dependent on aging contexts II
GSE168324 The mitochondrial-encoded MOTS-c prevents pancreatic islet destruction in autoimmune diabetes
GSE168439 Gene expression profile of mouse intestinal epithelial cells during homeostasis and villus atrophy
GSE169429 Gene expression profiles from the cardiac tissue of HIPK2-knockout and Wild Type (WT) mice
GSE169517 The gene expression in the kidney of selenium-binding protein1 deficient and C57BL/6J mice under 20 hours fasting condition
GSE171796 Gene expression profiling of cerebellums in the central nervous system-specific Derlin-2 deficient mice
GSE172042 Overexpression of miRNA-5100 with PEI-NPs led to change in expression of many mRNAs
GSE172044 MicroRNA expression profiling in acute kidney injury
GSE172046 Nrf2 depletion sensitizes pancreatic cancer cells to gemcitabine via aldehyde dehydrogenase 3a1 repression.
GSE174058 Differentially expressed genes of C2C12 cells influenced by murine pancreatic cancer derived exosomes
GSE174300 Expression data from mouse lung
GSE174323 Identify molecules regulated by glucosylceramide synthase in mouse osteoblasts.
GSE175419 Endothelial cell-specific reduction of heparan sulfate suppresses glioma growth in mice
GSE175511 Probing tumorigenic potentials of the genetic interactions reconstituted in murine fallopian tube organoids
GSE175512 Kras activation in endometrial organoids drives cellular transformation and epithelial-mesenchymal transition
GSE176356 SO018 visceral adipose tissue gene expression
GSE177039 Comparison of retinal gene expression among Chx10-cre;Tsc f/f, Chx10-cre;Tsc+/+ and 24-month-old C57BL/6 mice
GSE178087 Gene expression analysis of three tumor organoids (GAN-WT, GAN-p53 and GAN-KP) derived from gastric tumor in K19-Wnt1/C2mE (GAN) mouse.
GSE178729 Terahertz Exposure Enhances Neuronal Synaptic Transmission and Oligodendrocyte Differentiation in vitro
GSE178886 Comprehensive gene expression analysis in liver tissue following forced activation of Notch1 and Notch2 signaling.
GSE179125 The effects and underlying mechanisms of mutated hepatitis B virus X gene on the development of hepatocellular carcinoma
GSE179127 Functional study on the mutations of HBV X gene
GSE180115 Porphyromonas gingivalis alters gene expressions in the liver and brown adipose tissue, and induces gestational obesity and underweight of fetus in pregnant mice [BAT]
GSE180189 Porphyromonas gingivalis alters gene expressions in the liver and brown adipose tissue, and induces gestational obesity and underweight of fetus in pregnant mice [Liver]
GSE180287 Lung transcriptome profile in healthy and OVA-sensitized/challenged mice fed a diet supplemented with or without Cap or ODNcap
GSE180606 Network-based assessment of HDAC6 activity is highly predictive of pre-clinical and clinical responses to the HDAC6 inhibitor ricolinostat [array]
GSE180607 Network-based assessment of HDAC6 activity is highly predictive of pre-clinical and clinical responses to the HDAC6 inhibitor ricolinostat
GSE183138 Sorted HSCs from aged Specific Pathogen Free and germ free mice
GSE183207 Genes differentially expressed in brown adipose tissue between the control mice (rhebFL/FL) and rhebAD KO mice (fabp4-cre; rhebFL/FL)
GSE183345 The effect of meflin in the response to TGB-β stimulation in murine lung primary fibroblasts
GSE183360 A maternal high-fat diet induces fetal origins of NASH-HCC in mice
GSE183504 Development of Specific Therapy Against Right Ventricular Failure
GSE184052 Effects of Nfat1 knockout on the expression of pain-related genes in spinal cord
GSE184817 Lysophosphatidylcholine acyltransferase 1 controls the mitochondrial reactive oxygen species generation and survival of the retinal photoreceptor cells [P8 photoreceptor]
GSE184818 Lysophosphatidylcholine acyltransferase 1 controls the mitochondrial reactive oxygen species generation and survival of the retinal photoreceptor cells
GSE185873 Stat5b inhibition blocks proliferation and tumorigenicity of glioblastoma stem cells derived from a de novo murine brain cancer model
GSE186030 Expression profile of BAT and gWAT from adipose tissue-specific Pgam1 deficient mice
GSE186100 Lysyl hydroxylase 2 deficiency promotes filopodia formation and fibroblast migration
GSE188196 IkappaBzeta Controls IL-17-triggered Gene Expression Program in Intestinal Epithelial Cells that Prevents Expansion of SFB and Attenuates Autoimmune Disorders [ilea]
GSE188254 IkappaBzeta Controls IL-17-triggered Gene Expression Program in Intestinal Epithelial Cells that Prevents Expansion of SFB and Attenuates Autoimmune Disorders
GSE188360 CDC-like Kinase 4 Deficiency Contributes to Pathological Cardiac Hypertrophy by Modulating NEXN Phosphorylation
GSE189478 Differentially expressed genes induced by TPA stimulation between the P2ry6+/+ and P2ry6-/- mice
GSE192532 Development of gene expression signatures for mice with renal ischemia repurfusion injury.
GSE192604 An organoid-based transplantation model reveals genetic interactions potentiating niche-independent gastric carcinogenesis
GSE193098 MCG 101 tumors implanted on prostaglandin receptor EP2 wildtype and EP2 knockout mice
GSE194073 Effect of high-dose cyclophosphamide gene expression profiles in cardiomyocytes of C57BL/6J mice
GSE196257 Global cardiac gene expression in left ventricles from 20 day-old and 60 day-old Efnb1 CMspe KO and WT male mice
GSE196465 Differential gene expression profile between WT and FAM21 cKO bone marrow derived dendritic cells (BMDC).
GSE197087 Ectopic expression of Ino80 complex subunit Actr5 in mouse heart
GSE197888 Transcriptome Alterations in ASMT Knockout-Induced Depression-Like Behaviors and Exercise Effects
GSE198570 Oral microbiota shapes the gut microbiota, resulting in systemic effects
GSE199581 Microarray-based gene expression profiling in mouse bleomycin-induced systemic sclerosis model treated with MT-7117
GSE199950 Lymphatic vessels drain monosodium urate and activate immunity in gouty arthritis
GSE201275 Pigment epithelium–derived factor promotes peritoneal dissemination of ovarian cancer through induction of immunosuppressive macrophages
GSE202586 Microarray analysis of hub genes, non-coding RNAs and pathways in lung after whole body irradiation in a mouse model
GSE203597 Fibroblast-specific reduction of heparan sulfate suppresses colon tumor growth in mice
GSE203598 Fibroblast-specific reduction of heparan sulfate suppresses pancreatic cancer growth in mice
GSE203602 Fibroblast-specific reduction of heparan sulfate suppresses colon tumor growth and pancreatic cancer growth in mice
GSE205662 Gene expression profile of brain tissue in wild-type and MSA Tg mice at the age of 16 weeks
GSE205928 Gene expression signatures for anti-glioma therapy with Ad-SGE-REIC and bevacizumab
GSE208622 Loss of GPHR in the brain
GSE208735 Effect of Fumonisin B1 exposure on hepatic gene expression in mice fed a regular diet (CHOW) and in mice fed a High Fat Diet (HFD).
GSE209842 Gene expression profile of brain tissue in wild-type and MSA Tg mice at the age of 24 weeks
GSE210237 Gene expression profiles of Wnt4 high and Wnt4 low populations of murine islets at postnatal day 1 (P1).
GSE210267 Gene expression profiles of islets of Langerhans isolated from 7 weeks wt and Wnt4 conditional knock outs.
GSE213155 Role of gut microbiota in modulation of dendritic cell mediated immune tolerance with age
GSE213389 RAW macrophages: Control vs. LPS treated or Immunobiotic treated
GSE213844 Connexin 30 deficiency ameliorates the disease progression of amyotrophic lateral sclerosis model mice by suppressing glial inflammation.
GSE218508 Gene expression changes in mouse hippocampus after overnight exposure to corticosterone
GSE218744 Gene expression analysis of control and Dnd1-cKO germ cells at E12.5 and E13.5.
GSE220106 Sham vs.BCAS microarray for brain
GSE222060 The interplay between dietary fatty acids and gut microbiota influences host metabolism and hepatic steatosis
GSE222953 The ureters of Col17a1-KO mice at 4 days after unilateral ureteral obsruction
GSE223208 LncRNA CCRR Attenuates Inflammatory Response after Myocardial Infarction by Inhibiting TLR Signaling Pathway
GSE223520 Single-walled vs. Multi-walled Carbon Nanotubes: Influence of Physico-Chemical Properties on Toxicogenomics Responses in Mouse Lungs
GSE225477 Huangqi Decoction ameliorates kidney injury in db/db mice by regulating the BMP/Smad signaling pathway
GSE226304 Gene expression of Wild Type and SR-A1-/- abdominal aortic tissues after CaPO4-envoked
GSE226807 The role and mechanism of R-spondin3 in pulmonary vascular barrier dysfunction induced by mechanical ventilation
GSE227610 Ileum single cells expression in mice lacking Pgc1α in the intestine in response to western diet feeding.
GSE228053 Renal tubular Pck1 knockout mice showed albuminuria.
GSE228554 Sexually dimorphic impact of constitutive androstane receptor activation in mouse liver
GSE229041 Liver and bone marrow response to phlebotomy in Erfe-/- mice
GSE229291 Gene expression profiling of Cav1 knock down in murine hepatic stellate cell
GSE234591 Dietary amino acid source elicits sex-specific metabolic response to diet-induced NAFLD in murine model.
GSE237042 Gene expression profiles of EpiSC-derived neural stem cell lines in comparison with EpiSC and embryonic CNS
GSE239516 Sex differences in colonic gene expression in a mouse model of obesity-associated colorectal cancer
GSE246159 FE1 lung epithelial cells: Control vs nanoparticle, microparticle, metal chloride exposed
GSE249144 Development of gene expression signatures of liver in a primary Sjögren's syndrome mouse model
GSE249488 Identification of Messenger RNA Signatures in Age-Dependent Renal Impairment
GSE249490 The expression data from mandibular arch and tongue primordia in mouse embryos.
GSE250147 A tumor endothelial cell-specific microRNA replacement therapy for hepatocellular carcinoma
GSE251675 Differentially expressed genes induced by UVB stimulation between the P2ry6+/+ and P2ry6-/- mice
GSE262585 Dissecting the respective role of microbiota and host genetics in the susceptibility of Card9-/- mice to colitis
Data table header descriptions ID Agilent Probe Name
CONTROL_TYPE Control type
REFSEQ RefSeqAccession
GB_ACC GenBank Accession number
LOCUSLINK_ID LocuslinkID
GENE_SYMBOL Gene Symbol
GENE_NAME Gene Name
UNIGENE_ID UnigeneID
ENSEMBL_ID EnsemblID
ACCESSION_STRING Accession String
CHROMOSOMAL_LOCATION Chromosomal Location
CYTOBAND Cytoband
DESCRIPTION Description
GO_ID GoIDs
SEQUENCE Sequence
SPOT_ID Spot identifier
Data table ID CONTROL_TYPE REFSEQ GB_ACC LOCUSLINK_ID GENE_SYMBOL GENE_NAME UNIGENE_ID ENSEMBL_ID ACCESSION_STRING CHROMOSOMAL_LOCATION CYTOBAND DESCRIPTION GO_ID SEQUENCE SPOT_ID A_51_P100034
FALSE
NM_027162
NM_027162 69674
Mif4gd
MIF4G domain containing
Mm.390387
ref|NM_027162|ref|NM_001243586|ref|NM_001243587|ref|NM_001243584
chr11:115469328-115469269
mm|11qE2
Mus musculus MIF4G domain containing (Mif4gd), transcript variant 1, mRNA [NM_027162]
GO:0003723(RNA binding)|GO:0005634(nucleus)|GO:0005730(nucleolus)|GO:0005737(cytoplasm)|GO:0006417(regulation of translation)|GO:0008022(protein C-terminus binding)
GAGACTTTTGTGGAGGAAGCCTGTTTCCTCCAGTCATGAGTGACTGCCTCACCAGGTTGG
A_51_P100174
FALSE
NM_008613
NM_008613 17427
Mns1
meiosis-specific nuclear structural protein 1
Mm.387671
ref|NM_008613|ref|XM_011242665|ref|XM_006510824|gb|D14849
chr9:72306274-72306333
mm|9qD
Mus musculus meiosis-specific nuclear structural protein 1 (Mns1), mRNA [NM_008613]
GO:0005634(nucleus)|GO:0005635(nuclear envelope)|GO:0005882(intermediate filament)|GO:0005930(axoneme)|GO:0036126(sperm flagellum)|GO:0042802(identical protein binding)|GO:0051321(meiotic cell cycle)|GO:0070986(left/right axis specification)
CTGTTTTACAGTTGGTGACAGTAGGCCCTGGTCTATCTGCATGTTCTAAAACATCCTCCT
A_51_P100208
FALSE
NM_177906
NM_177906 330908
Opcml
opioid binding protein/cell adhesion molecule-like
Mm.379474
ENSMUST00000115243
ref|NM_177906|ens|ENSMUST00000115243|ref|XM_006510437|ref|XM_006510438
chr9:28731887-28731946
mm|9qA4
Mus musculus opioid binding protein/cell adhesion molecule-like (Opcml), mRNA [NM_177906]
GO:0003674(molecular_function)|GO:0005886(plasma membrane)|GO:0005911(cell-cell junction)|GO:0008150(biological_process)|GO:0009986(cell surface)|GO:0016337(cell-cell adhesion)|GO:0043005(neuron projection)|GO:0043025(neuronal cell body)|GO:0050767(regulation of neurogenesis)|GO:0070062(extracellular vesicular exosome)
TTTGGGTTTTCTTTGGCATAAACCTTATTTCTAGAAATCCTCATGTCCAATTGCTTTCCC
A_51_P100289
FALSE
NM_020493
NM_020493 20807
Srf
serum response factor
Mm.45044
ENSMUST00000015749
ref|NM_020493|ens|ENSMUST00000015749|ref|XM_006523957|ref|XM_011246336
chr17:46683795-46683788
mm|17qC
Mus musculus serum response factor (Srf), mRNA [NM_020493]
GO:0000790(nuclear chromatin)|GO:0000978(RNA polymerase II core promoter proximal region sequence-specific DNA binding)|GO:0000983(RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity)|GO:0001076(RNA polymerase II transcription factor binding transcription factor activity)|GO:0001077(RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription)|GO:0001228(RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription)|GO:0001569(patterning of blood vessels)|GO:0001701(in utero embryonic development)|GO:0001707(mesoderm formation)|GO:0001764(neuron migration)|GO:0001829(trophectodermal cell differentiation)|GO:0001947(heart looping)|GO:0002011(morphogenesis of an epithelial sheet)|GO:0002042(cell migration involved in sprouting angiogenesis)|GO:0002521(leukocyte differentiation)|GO:0003257(positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation)|GO:0003677(DNA binding)|GO:0003682(chromatin binding)|GO:0003700(sequence-specific DNA binding transcription factor activity)|GO:0003705(RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity)|GO:0005515(protein binding)|GO:0005623(cell)|GO:0005634(nucleus)|GO:0005737(cytoplasm)|GO:0006351(transcription, DNA-dependent)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0006366(transcription from RNA polymerase II promoter)|GO:0007015(actin filament organization)|GO:0007160(cell-matrix adhesion)|GO:0007275(multicellular organismal development)|GO:0007369(gastrulation)|GO:0007507(heart development)|GO:0007616(long-term memory)|GO:0008134(transcription factor binding)|GO:0008285(negative regulation of cell proliferation)|GO:0008306(associative learning)|GO:0009725(response to hormone stimulus)|GO:0010669(epithelial structure maintenance)|GO:0010735(positive regulation of transcription via serum response element binding)|GO:0010736(serum response element binding)|GO:0016337(cell-cell adhesion)|GO:0021766(hippocampus development)|GO:0022028(tangential migration from the subventricular zone to the olfactory bulb)|GO:0030036(actin cytoskeleton organization)|GO:0030038(contractile actin filament bundle assembly)|GO:0030155(regulation of cell adhesion)|GO:0030168(platelet activation)|GO:0030220(platelet formation)|GO:0030336(negative regulation of cell migration)|GO:0031175(neuron projection development)|GO:0031490(chromatin DNA binding)|GO:0033561(regulation of water loss via skin)|GO:0034097(response to cytokine stimulus)|GO:0035855(megakaryocyte development)|GO:0035912(dorsal aorta morphogenesis)|GO:0042789(mRNA transcription from RNA polymerase II promoter)|GO:0042803(protein homodimerization activity)|GO:0042826(histone deacetylase binding)|GO:0043149(stress fiber assembly)|GO:0043565(sequence-specific DNA binding)|GO:0043589(skin morphogenesis)|GO:0045059(positive thymic T cell selection)|GO:0045214(sarcomere organization)
GGTGTATCCCTAATTAAGTGCCTCTAGGGGTGTGTGCGCGCGCCTGTGTCCTGAGTGAAT
A_51_P100309
FALSE
NM_001039652
NM_001039652 18390
Oprm1
opioid receptor, mu 1
Mm.439715
ref|NM_001039652|ref|NM_001304938|ref|NM_001304937|ref|NM_001302793
chr10:3516213-3516154
mm|10qA1
Mus musculus opioid receptor, mu 1 (Oprm1), transcript variant MOR-1C, mRNA [NM_001039652]
GO:0001965(G-protein alpha-subunit binding)|GO:0004871(signal transducer activity)|GO:0004930(G-protein coupled receptor activity)|GO:0004979(beta-endorphin receptor activity)|GO:0004985(opioid receptor activity)|GO:0005245(voltage-gated calcium channel activity)|GO:0005515(protein binding)|GO:0005737(cytoplasm)|GO:0005829(cytosol)|GO:0005886(plasma membrane)|GO:0005887(integral to plasma membrane)|GO:0005925(focal adhesion)|GO:0007165(signal transduction)|GO:0007186(G-protein coupled receptor signaling pathway)|GO:0007191(adenylate cyclase-activating dopamine receptor signaling pathway)|GO:0007193(adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway)|GO:0007194(negative regulation of adenylate cyclase activity)|GO:0007200(phospholipase C-activating G-protein coupled receptor signaling pathway)|GO:0007204(elevation of cytosolic calcium ion concentration)|GO:0007218(neuropeptide signaling pathway)|GO:0007268(synaptic transmission)|GO:0007626(locomotory behavior)|GO:0008022(protein C-terminus binding)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0019233(sensory perception of pain)|GO:0019904(protein domain specific binding)|GO:0030425(dendrite)|GO:0030818(negative regulation of cAMP biosynthetic process)|GO:0031005(filamin binding)|GO:0031635(adenylate cyclase-inhibiting opioid receptor signaling pathway)|GO:0031681(G-protein beta-subunit binding)|GO:0032100(positive regulation of appetite)|GO:0032590(dendrite membrane)|GO:0032839(dendrite cytoplasm)|GO:0033554(cellular response to stress)|GO:0038003(opioid receptor signaling pathway)|GO:0038047(morphine receptor activity)|GO:0042383(sarcolemma)|GO:0042755(eating behavior)|GO:0042923(neuropeptide binding)|GO:0043005(neuron projection)|GO:0043204(perikaryon)|GO:0043950(positive regulation of cAMP-mediated signaling)|GO:0043951(negative regulation of cAMP-mediated signaling)|GO:0045019(negative regulation of nitric oxide biosynthetic process)|GO:0045121(membrane raft)|GO:0045429(positive regulation of nitric oxide biosynthetic process)|GO:0045471(response to ethanol)|GO:0048149(behavioral response to ethanol)|GO:0050769(positive regulation of neurogenesis)|GO:0051481(reduction of cytosolic calcium ion concentration)|GO:0051930(regulation of sensory perception of pain)|GO:0060079(regulation of excitatory postsynaptic membrane potential)|GO:0061358(negative regulation of Wnt protein secretion)|GO:0070374(positive regulation of ERK1 and ERK2 cascade)|GO:0070588(calcium ion transmembrane transport)|GO:0071315(cellular response to morphine)|GO:2000310(regulation of N-methyl-D-aspartate selective glutamate receptor activity)
GCCTGAACCCAGTTCTTTATGCGTTCCTGGATGAAAACTTCAAACGATGTTTTAGAGAGT
A_51_P100327
FALSE
NM_013683
NM_013683 21354
Tap1
transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
Mm.482076
ENSMUST00000166582
ref|NM_013683|ref|NM_001161730|ens|ENSMUST00000166582|ens|ENSMUST00000041633
chr17:34330854-34330913
mm|17qB1
Mus musculus transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) (Tap1), transcript variant 1, mRNA [NM_013683]
GO:0000166(nucleotide binding)|GO:0002376(immune system process)|GO:0005524(ATP binding)|GO:0005576(extracellular region)|GO:0005739(mitochondrion)|GO:0005783(endoplasmic reticulum)|GO:0006810(transport)|GO:0006952(defense response)|GO:0008152(metabolic process)|GO:0015031(protein transport)|GO:0015197(peptide transporter activity)|GO:0015440(peptide-transporting ATPase activity)|GO:0015833(peptide transport)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016887(ATPase activity)|GO:0019060(intracellular transport of viral proteins in host cell)|GO:0019885(antigen processing and presentation of endogenous peptide antigen via MHC class I)|GO:0023029(MHC class Ib protein binding)|GO:0030176(integral to endoplasmic reticulum membrane)|GO:0042270(protection from natural killer cell mediated cytotoxicity)|GO:0042287(MHC protein binding)|GO:0042288(MHC class I protein binding)|GO:0042605(peptide antigen binding)|GO:0042626(ATPase activity, coupled to transmembrane movement of substances)|GO:0042803(protein homodimerization activity)|GO:0042825(TAP complex)|GO:0043231(intracellular membrane-bounded organelle)|GO:0043531(ADP binding)|GO:0043657(host cell)|GO:0046967(cytosol to ER transport)|GO:0046978(TAP1 binding)|GO:0046979(TAP2 binding)|GO:0046980(tapasin binding)|GO:0046982(protein heterodimerization activity)|GO:0055085(transmembrane transport)
TATTTGGAAGAAGTTTTCGAGAAAATATTGCGTATGGCCTGAACCGGACTCCAACCATGG
A_51_P100428
FALSE
AK076663 102633419
Gm31251
predicted gene, 31251
Mm.444665
gb|AK076663|riken|4930408C10|nap|NAP088623-1
chr14:55610280-55610339
mm|14qC3
Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930408C10 product:myosin heavy chain, cardiac muscle, adult, full insert sequence. [AK076663]
AGGAAAATGAAGAAAGGCGATACATGGGCTTTTCCAAATGAGCTTATACATGAATGAAGA
A_51_P100519
FALSE
AK016018 75163
4930542C16Rik
RIKEN cDNA 4930542C16 gene
Mm.491636
gb|AK016018|gb|XR_168524|tc|TC1595163|riken|4930542C16
chr14:25435102-25435043
mm|14qA3
Mus musculus adult male testis cDNA, RIKEN full-length enriched library, clone:4930542C16 product:hypothetical protein, full insert sequence. [AK016018]
GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0008150(biological_process)
GCTATCTGTTTTTTCAAACATAGATGTGGAATTAGGAAGTGAGAAAGAAATGGAATCTGG
A_51_P100537
FALSE
NM_175020
NM_175020 232717
Prss58
protease, serine 58
Mm.56997
ENSMUST00000063523
ref|NM_175020|ens|ENSMUST00000063523|gb|AK075754|gb|BC048599
chr6:40845394-40845335
mm|6qB1
Mus musculus protease, serine 58 (Prss58), mRNA [NM_175020]
GO:0004252(serine-type endopeptidase activity)|GO:0005575(cellular_component)|GO:0005576(extracellular region)|GO:0006508(proteolysis)|GO:0008233(peptidase activity)|GO:0008236(serine-type peptidase activity)|GO:0016787(hydrolase activity)
GCCCTGGATTGAAGATACCATGAAAAATAACTGAGCTCCCACAACAGGAGGAATTCTGAA
A_51_P100573
FALSE
NM_011947
NM_011947 26406
Map3k3
mitogen-activated protein kinase kinase kinase 3
Mm.27041
ENSMUST00000002044
ref|NM_011947|ens|ENSMUST00000002044|gb|U43187|gb|AK220450
chr11:106015867-106015926
mm|11qE1
Mus musculus mitogen-activated protein kinase kinase kinase 3 (Map3k3), mRNA [NM_011947]
GO:0000165(MAPK cascade)|GO:0000166(nucleotide binding)|GO:0000187(activation of MAPK activity)|GO:0001568(blood vessel development)|GO:0004672(protein kinase activity)|GO:0004674(protein serine/threonine kinase activity)|GO:0004708(MAP kinase kinase activity)|GO:0004709(MAP kinase kinase kinase activity)|GO:0005515(protein binding)|GO:0005524(ATP binding)|GO:0005622(intracellular)|GO:0006468(protein phosphorylation)|GO:0016301(kinase activity)|GO:0016310(phosphorylation)|GO:0016740(transferase activity)|GO:0016772(transferase activity, transferring phosphorus-containing groups)|GO:0035556(intracellular signal transduction)|GO:0046777(protein autophosphorylation)|GO:0046872(metal ion binding)|GO:1900745(positive regulation of p38MAPK cascade)
CAAGGGTATGAATAGTGTTACTTCATTCAGAGTGTTACTTTGTTTCTCTCCCAATGTTTG
A_51_P100624
FALSE
NM_029351
NM_029351 75586
Krtap9-3
keratin associated protein 9-3
Mm.75707
ENSMUST00000062683
ref|NM_029351|ens|ENSMUST00000062683|gb|AK009730|gb|AK131927
chr11:99458872-99458813
mm|11qD
Mus musculus keratin associated protein 9-3 (Krtap9-3), mRNA [NM_029351]
GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0005882(intermediate filament)|GO:0008150(biological_process)|GO:0045095(keratin filament)
TGATAACTCAGCTATTGACACGGCTACATAATTTCCCAGGAGGTAAATTCATTTGGGGTG
A_51_P100625
FALSE
NM_133996
NM_133996 28194
Apon
apolipoprotein N
Mm.439846
ENSMUST00000060782
ref|NM_133996|ens|ENSMUST00000060782|gb|AK083289|gb|BC022137
chr10:127692512-127692571
mm|10qD3
Mus musculus apolipoprotein N (Apon), mRNA [NM_133996]
GO:0003674(molecular_function)|GO:0005615(extracellular space)|GO:0005737(cytoplasm)|GO:0008150(biological_process)
AGCTGAATTCTGGGCCTTGGTTGTATTCATATTGTTTTGGGATATTAAGGAAAGGAAGGT
A_51_P100776
FALSE
NM_026450
NM_026450 67911
Zfp169
zinc finger protein 169
Mm.251375
ENSMUST00000110110
ref|NM_026450|ref|NM_001164575|ens|ENSMUST00000110110|ens|ENSMUST00000177530
chr13:48585061-48585002
mm|13qA5
Mus musculus zinc finger protein 169 (Zfp169), transcript variant 1, mRNA [NM_026450]
GO:0003674(molecular_function)|GO:0005575(cellular_component)|GO:0008150(biological_process)
GTACTGAGTGTGGTCGAGCCTTTGAGTTTAAGTCTCTTTTCATCAGACACCAAAAGACAC
A_51_P100785
FALSE
NM_025507
NM_025507 66354
Snw1
SNW domain containing 1
Mm.271174
ref|NM_025507|gb|AX775977|gb|AK009218|gb|BC049245
chr12:88790936-88790877
mm|12qD2
Mus musculus SNW domain containing 1 (Snw1), mRNA [NM_025507]
GO:0000122(negative regulation of transcription from RNA polymerase II promoter)|GO:0000398(nuclear mRNA splicing, via spliceosome)|GO:0000785(chromatin)|GO:0003713(transcription coactivator activity)|GO:0003714(transcription corepressor activity)|GO:0005112(Notch binding)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005654(nucleoplasm)|GO:0005681(spliceosomal complex)|GO:0006351(transcription, DNA-dependent)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0006397(mRNA processing)|GO:0008024(positive transcription elongation factor complex b)|GO:0008380(RNA splicing)|GO:0016363(nuclear matrix)|GO:0030511(positive regulation of transforming growth factor beta receptor signaling pathway)|GO:0035257(nuclear hormone receptor binding)|GO:0035914(skeletal muscle cell differentiation)|GO:0042771(DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis)|GO:0042809(vitamin D receptor binding)|GO:0042974(retinoic acid receptor binding)|GO:0043923(positive regulation by host of viral transcription)|GO:0045892(negative regulation of transcription, DNA-dependent)|GO:0045944(positive regulation of transcription from RNA polymerase II promoter)|GO:0046332(SMAD binding)|GO:0048026(positive regulation of nuclear mRNA splicing, via spliceosome)|GO:0048384(retinoic acid receptor signaling pathway)|GO:0048385(regulation of retinoic acid receptor signaling pathway)|GO:0050769(positive regulation of neurogenesis)|GO:0051571(positive regulation of histone H3-K4 methylation)|GO:0070562(regulation of vitamin D receptor signaling pathway)|GO:0070564(positive regulation of vitamin D receptor signaling pathway)|GO:0071013(catalytic step 2 spliceosome)|GO:0071146(SMAD3-SMAD4 protein complex)|GO:0071300(cellular response to retinoic acid)
TTCTCCACCGCGCCATGGGGAACTAAGGTCTTGCTTAGTGCACCTCATTTCAAATAAAAA
A_51_P100787
FALSE
NM_025507
NM_025507 66354
Snw1
SNW domain containing 1
Mm.271174
ENSMUST00000021428
ref|NM_025507|ens|ENSMUST00000021428|gb|AX775977|gb|AK009218
chr12:88791047-88790988
mm|12qD2
Mus musculus SNW domain containing 1 (Snw1), mRNA [NM_025507]
GO:0000122(negative regulation of transcription from RNA polymerase II promoter)|GO:0000398(nuclear mRNA splicing, via spliceosome)|GO:0000785(chromatin)|GO:0003713(transcription coactivator activity)|GO:0003714(transcription corepressor activity)|GO:0005112(Notch binding)|GO:0005515(protein binding)|GO:0005634(nucleus)|GO:0005654(nucleoplasm)|GO:0005681(spliceosomal complex)|GO:0006351(transcription, DNA-dependent)|GO:0006355(regulation of transcription, DNA-dependent)|GO:0006397(mRNA processing)|GO:0008024(positive transcription elongation factor complex b)|GO:0008380(RNA splicing)|GO:0016363(nuclear matrix)|GO:0030511(positive regulation of transforming growth factor beta receptor signaling pathway)|GO:0035257(nuclear hormone receptor binding)|GO:0035914(skeletal muscle cell differentiation)|GO:0042771(DNA damage response, signal transduction by p53 class mediator resulting in induction of apoptosis)|GO:0042809(vitamin D receptor binding)|GO:0042974(retinoic acid receptor binding)|GO:0043923(positive regulation by host of viral transcription)|GO:0045892(negative regulation of transcription, DNA-dependent)|GO:0045944(positive regulation of transcription from RNA polymerase II promoter)|GO:0046332(SMAD binding)|GO:0048026(positive regulation of nuclear mRNA splicing, via spliceosome)|GO:0048384(retinoic acid receptor signaling pathway)|GO:0048385(regulation of retinoic acid receptor signaling pathway)|GO:0050769(positive regulation of neurogenesis)|GO:0051571(positive regulation of histone H3-K4 methylation)|GO:0070562(regulation of vitamin D receptor signaling pathway)|GO:0070564(positive regulation of vitamin D receptor signaling pathway)|GO:0071013(catalytic step 2 spliceosome)|GO:0071146(SMAD3-SMAD4 protein complex)|GO:0071300(cellular response to retinoic acid)
CTAATCCAGCTGTAACCTTTTCTGTAAACGTTATGAATAACCTCACCTCAAATGGTGAGT
A_51_P100828
FALSE
NM_007452
NM_007452 11757
Prdx3
peroxiredoxin 3
Mm.29821
ENSMUST00000025961
ref|NM_007452|ens|ENSMUST00000025961|gb|BD174090|gb|M28723
chr19:60940207-60940148
mm|19qD3
Mus musculus peroxiredoxin 3 (Prdx3), mRNA [NM_007452]
GO:0001893(maternal placenta development)|GO:0004601(peroxidase activity)|GO:0005737(cytoplasm)|GO:0005739(mitochondrion)|GO:0005769(early endosome)|GO:0005829(cytosol)|GO:0006915(apoptotic process)|GO:0006979(response to oxidative stress)|GO:0007005(mitochondrion organization)|GO:0008022(protein C-terminus binding)|GO:0008284(positive regulation of cell proliferation)|GO:0008379(thioredoxin peroxidase activity)|GO:0008385(IkappaB kinase complex)|GO:0016209(antioxidant activity)|GO:0016491(oxidoreductase activity)|GO:0018171(peptidyl-cysteine oxidation)|GO:0019900(kinase binding)|GO:0019901(protein kinase binding)|GO:0030099(myeloid cell differentiation)|GO:0032496(response to lipopolysaccharide)|GO:0033673(negative regulation of kinase activity)|GO:0034599(cellular response to oxidative stress)|GO:0034614(cellular response to reactive oxygen species)|GO:0042542(response to hydrogen peroxide)|GO:0042744(hydrogen peroxide catabolic process)|GO:0042802(identical protein binding)|GO:0043027(cysteine-type endopeptidase inhibitor activity involved in apoptotic process)|GO:0043066(negative regulation of apoptotic process)|GO:0043154(negative regulation of cysteine-type endopeptidase activity involved in apoptotic process)|GO:0043209(myelin sheath)|GO:0043524(negative regulation of neuron apoptotic process)|GO:0051092(positive regulation of NF-kappaB transcription factor activity)|GO:0051881(regulation of mitochondrial membrane potential)|GO:0051920(peroxiredoxin activity)|GO:0055114(oxidation-reduction process)|GO:0070062(extracellular vesicular exosome)
GCACATAGCACCAGCACTTAATGGAAGCTTCTGATCAAGGTCCTAAAATTTCCTCTTGAA
A_51_P100836
FALSE
NM_009702
NM_009702 11834
Aqr
aquarius
Mm.2545
ENSMUST00000126701
ref|NM_009702|ref|NM_001290788|ens|ENSMUST00000126701|ens|ENSMUST00000125460
chr2:113962656-113960547
mm|2qE4
Mus musculus aquarius (Aqr), transcript variant 1, mRNA [NM_009702]
GO:0000398(nuclear mRNA splicing, via spliceosome)|GO:0003723(RNA binding)|GO:0005634(nucleus)|GO:0005654(nucleoplasm)|GO:0005681(spliceosomal complex)|GO:0006397(mRNA processing)|GO:0008150(biological_process)|GO:0008380(RNA splicing)|GO:0016020(membrane)|GO:0071013(catalytic step 2 spliceosome)
ATGTCACCATCAATCTGAATGTCAGAGACCACATCAAGGATGAGTGGGAAGGTCTTCGAA
A_51_P100852
FALSE
NM_175449
NM_175449 215900
Fam26f
family with sequence similarity 26, member F
Mm.34479
ENSMUST00000062784
ref|NM_175449|ens|ENSMUST00000062784|gb|AK153519|gb|AK080048
chr10:33846270-33846211
mm|10qB1
Mus musculus family with sequence similarity 26, member F (Fam26f), mRNA [NM_175449]
GO:0003674(molecular_function)|GO:0005261(cation channel activity)|GO:0005575(cellular_component)|GO:0005887(integral to plasma membrane)|GO:0006810(transport)|GO:0006811(ion transport)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0034220(ion transmembrane transport)
TGGGAAATCTATTGGGAAAAGGAGAAGCAGATTCTTCAAAATCAAGCTGCAGAGAATGCG
A_51_P100856
FALSE
NM_010233
NM_010233 14268
Fn1
fibronectin 1
Mm.193099
ref|NM_010233|ref|NM_001276408|ref|NM_001276409|ref|NM_001276410
chr1:71639659-71637422
mm|1qC3
Mus musculus fibronectin 1 (Fn1), transcript variant 1, mRNA [NM_010233]
GO:0001525(angiogenesis)|GO:0001775(cell activation)|GO:0002020(protease binding)|GO:0005178(integrin binding)|GO:0005515(protein binding)|GO:0005576(extracellular region)|GO:0005577(fibrinogen complex)|GO:0005578(proteinaceous extracellular matrix)|GO:0005604(basement membrane)|GO:0005605(basal lamina)|GO:0005615(extracellular space)|GO:0005793(endoplasmic reticulum-Golgi intermediate compartment)|GO:0006953(acute-phase response)|GO:0007044(cell-substrate junction assembly)|GO:0007155(cell adhesion)|GO:0007160(cell-matrix adhesion)|GO:0007161(calcium-independent cell-matrix adhesion)|GO:0008201(heparin binding)|GO:0008347(glial cell migration)|GO:0008360(regulation of cell shape)|GO:0010952(positive regulation of peptidase activity)|GO:0016324(apical plasma membrane)|GO:0016504(peptidase activator activity)|GO:0018149(peptide cross-linking)|GO:0030198(extracellular matrix organization)|GO:0030335(positive regulation of cell migration)|GO:0031012(extracellular matrix)|GO:0033622(integrin activation)|GO:0034446(substrate adhesion-dependent cell spreading)|GO:0035987(endodermal cell differentiation)|GO:0042060(wound healing)|GO:0043066(negative regulation of apoptotic process)|GO:0045340(mercury ion binding)|GO:0045773(positive regulation of axon extension)|GO:0050921(positive regulation of chemotaxis)|GO:0070062(extracellular vesicular exosome)|GO:0071288(cellular response to mercury ion)|GO:0071347(cellular response to interleukin-1)|GO:0072562(blood microparticle)
GATGCGATTCATCTAAATGGTGCCATGACAACGGTGTCAACTACAAGATCGGAGAGAAGT
A_51_P100991
FALSE
NM_145067
NM_145067 14917
Gucy2c
guanylate cyclase 2c
Mm.222729
ENSMUST00000032338
ref|NM_145067|ref|NM_001127318|ens|ENSMUST00000032338|ens|ENSMUST00000078095
chr6:136648027-136646532
mm|6qG1
Mus musculus guanylate cyclase 2c (Gucy2c), transcript variant 2, mRNA [NM_145067]
GO:0000166(nucleotide binding)|GO:0004383(guanylate cyclase activity)|GO:0004672(protein kinase activity)|GO:0005524(ATP binding)|GO:0005525(GTP binding)|GO:0005783(endoplasmic reticulum)|GO:0005886(plasma membrane)|GO:0006182(cGMP biosynthetic process)|GO:0006468(protein phosphorylation)|GO:0009190(cyclic nucleotide biosynthetic process)|GO:0009636(response to toxin)|GO:0015643(toxin binding)|GO:0016020(membrane)|GO:0016021(integral to membrane)|GO:0016772(transferase activity, transferring phosphorus-containing groups)|GO:0016829(lyase activity)|GO:0016849(phosphorus-oxygen lyase activity)|GO:0035556(intracellular signal transduction)|GO:0042127(regulation of cell proliferation)
AAGAATACAACCTGCCATCCCCACCGACAGTGGAGAACCAACAGCGCCTGCAGACTGAGT
56745 40952 Kbytes .Supplementary file Size Download File type/resource GPL21163_074809_D_GEO_20150624.txt.gz
11.4 Mb
(ftp) (http) TXT
Less...
More...